X

Use of cookies
This website stores cookies on your computer. These cookies are used to collect information about how you interact with our website and allow us to remember you. We use this information in order to improve and customize your browsing experience and for analytics and metrics about our visitors both on this website and other media. To find out more about the cookies we use, as well as to change their configuration, see our Cookie Policy.

Version 1.2

GeneDiseaseTranscriptMutationsproducts
ABCA4Cone-rod dystrophy type 3NM_000350.2NM_000350.2:c.3540_3555delGTCTAAGGGTTTCTCC, NM_000350.2:c.2616_2617delCT, NM_000350.2:c.4793C>A, NM_000350.2:c.6179T>G, NM_000350.2:c.1222C>T, NM_000350.2:c.763C>T250,600
ABCA4Retinitis pigmentosa type 19NM_000350.2NM_000350.2:c.1848delA250,600
ABCA4Stargardt disease type 1NM_000350.2NM_000350.2:c.1018T>G, NM_000350.2:c.4457C>T, NM_000350.2:c.1225delA, NM_000350.2:c.1622T>C, NM_000350.2:c.1715G>A, NM_000350.2:c.1755delA, NM_000350.2:c.1771delT, NM_000350.2:c.1804C>T, NM_000350.2:c.6449G>A, NM_000350.2:c.1938-1G>A, NM_000350.2:c.1964T>G, NM_000350.2:c.2160+1G>T, NM_000350.2:c.2588G>C, NM_000350.2:c.4469G>A, NM_000350.2:c.2690C>T, NM_000350.2:c.2791G>A, NM_000350.2:c.286A>G, NM_000350.2:c.2971G>C, NM_000350.2:c.3083C>T, NM_000350.2:c.3106G>A, NM_000350.2:c.3210_3211dupGT, NM_000350.2:c.3364G>A, NM_000350.2:c.6320G>A, NM_000350.2:c.3970delG, NM_000350.2:c.4139C>T, NM_000350.2:c.4429C>T, NM_000350.2:c.2300T>A, NM_000350.2:c.3322C>T, NM_000350.2:c.52C>T, NM_000350.2:c.5512delC, NM_000350.2:c.5819T>C, NM_000350.2:c.5881G>A, NM_000350.2:c.5882G>A, NM_000350.2:c.5912T>G, NM_000350.2:c.634C>T, NM_000350.2:c.5714+5G>A, NM_000350.2:c.6394G>T, NM_000350.2:c.67-2A>G, NM_000350.2:c.5461-10T>C, NM_000350.2:c.6089G>A, NM_000350.2:c.6118C>T, NM_000350.2:c.6148G>C, NM_000350.2:c.661G>A, NM_000350.2:c.5338C>G250,600
ABCB7Sideroblastic anemia and ataxia, X-linkedNM_004299.4NM_004299.4:c.1203T>G, NM_004299.4:c.1234G>C, NM_004299.4:c.1300G>A600
ACAD9Acyl-CoA dehydrogenase type 9 deficiencyNM_014049.4NM_014049.4:c.1240C>T, NM_014049.4:c.1249C>T, NM_014049.4:c.130T>A, NM_014049.4:c.1594C>T, NM_014049.4:c.23delT, NM_014049.4:c.358delT, NM_014049.4:c.797G>A, NM_014049.4:c.976G>C, NM_014049.4:c.453+1G>A250,600
ACADMAcyl-CoA dehydrogenase deficiency, medium-chainNM_000016.5NM_000016.5:c.1102_1105delTTAG, NM_000016.5:c.1232_1233delAA, NM_000016.5:c.287-2A>G, NM_000016.5:c.362C>T, NM_000016.5:c.447G>A, NM_000016.5:c.447G>T, NM_000016.5:c.449_452delCTGA, NM_000016.5:c.616C>T, NM_000016.5:c.617G>A, NM_000016.5:c.683C>A, NM_000016.5:c.797A>G, NM_000016.5:c.799G>A, NM_000016.5:c.815_827delTTGCAATGGGAGC, NM_000016.5:c.890A>G, NM_000016.5:c.984delG, NM_000016.5:c.985A>G, NM_000016.5:c.127G>A, NM_000016.5:c.734C>T, NM_000016.5:c.250C>T250,600
ACADSAcyl-CoA dehydrogenase deficiency, short-chainNM_000017.2NM_000017.2:c.1095G>T, NM_000017.2:c.1108A>G, NM_000017.2:c.1147C>T, NM_000017.2:c.136C>T, NM_000017.2:c.319C>T, NM_000017.2:c.417G>C, NM_000017.2:c.529T>C, NM_000017.2:c.561_568delCAATGCCT, NM_000017.2:c.826G>A, NM_000017.2:c.314T>A250,600
ACADSB2-Methylbutyryl-CoA dehydrogenase deficiencyNM_001609.3NM_001609.3:c.1159G>A, NM_001609.3:c.443C>T, NM_001609.3:c.763C>T, NM_001609.3:c.621G>A, NM_001609.3:c.303+1G>A250,600
ACADVLVery long chain acyl-CoA dehydrogenase deficiencyNM_000018.3NM_000018.3:c.1096C>T, NM_000018.3:c.1097G>A, NM_000018.3:c.1106T>C, NM_000018.3:c.1141_1143delGAG, NM_000018.3:c.1182+1G>A, NM_000018.3:c.1357C>T, NM_000018.3:c.1360G>A, NM_000018.3:c.1375dupC, NM_000018.3:c.1389dupG, NM_000018.3:c.1406G>A, NM_000018.3:c.1468G>C, NM_000018.3:c.1532+1G>A, NM_000018.3:c.1837C>T, NM_000018.3:c.1843C>T, NM_000018.3:c.1882delC, NM_000018.3:c.278-1G>A, NM_000018.3:c.298_299delCA, NM_000018.3:c.343delG, NM_000018.3:c.400C>T, NM_000018.3:c.477+1G>C, NM_000018.3:c.520G>A, NM_000018.3:c.685C>T, NM_000018.3:c.739A>C, NM_000018.3:c.753-2A>C, NM_000018.3:c.896_898delAGA, NM_000018.3:c.917T>C, NM_000018.3:c.1844G>A, NM_000018.3:c.848T>C250,600
ACAT1Beta-ketothiolase deficiencyNM_000019.3NM_000019.3:c.1035_1037delAGA, NM_000019.3:c.1083dupA, NM_000019.3:c.1136G>T, NM_000019.3:c.1138G>A, NM_000019.3:c.2T>A, NM_000019.3:c.410_417delCTCAAAGT, NM_000019.3:c.547G>A, NM_000019.3:c.622C>T, NM_000019.3:c.905delA600
ACERenal tubular dysgenesisNM_000789.3NM_000789.3:c.1319_1322delTGGA, NM_000789.3:c.1510delC, NM_000789.3:c.3381-4C>T, NM_000789.3:c.798C>G, NM_000789.3:c.1486C>T, NM_000789.3:c.2371C>T, NM_000789.3:c.1587-2A>G250,600
ACOX1Peroxisomal acyl-CoA oxidase deficiencyNM_004035.6NM_004035.6:c.832A>G, NM_004035.6:c.532G>T, NM_004035.6:c.591delG600
ACTN4Glomerulosclerosis, focal segmental, type 1NM_004924.4NM_004924.4:c.763A>G, NM_004924.4:c.2619_2620insC, NM_004924.4:c.776C>T, NM_004924.4:c.784T>C600
ADAAdenosine deaminase deficiencyNM_000022.2NM_000022.2:c.226C>T, NM_000022.2:c.632G>A, NM_000022.2:c.890C>A, NM_000022.2:c.247G>A, NM_000022.2:c.320T>C, NM_000022.2:c.872C>T, NM_000022.2:c.956_960delAAGAG, NM_000022.2:c.986C>T250,600
ADAMTS2Ehlers-Danlos syndrome type 7CNM_014244.4NM_014244.4:c.2384G>A600
ADAMTSL2Geleophysic dysplasia type 1NM_014694.3NM_014694.3:c.338G>A, NM_014694.3:c.440C>T, NM_014694.3:c.661C>T, NM_014694.3:c.340G>A600
ADCK3Primary coenzyme Q10 deficiency type 4NM_020247.4NM_020247.4:c.911C>T, NM_020247.4:c.815G>T, NM_020247.4:c.993C>T, NM_020247.4:c.1541A>G, NM_020247.4:c.1645G>A, NM_020247.4:c.1651G>A, NM_020247.4:c.1750_1752delACC, NM_020247.4:c.1813_1814insG, NM_020247.4:c.589-3C>G, NM_020247.4:c.637C>T, NM_020247.4:c.815G>A250,600
AGAAspartylglucosaminuriaNM_000027.3NM_000027.3:c.488G>C, NM_000027.3:c.755G>A, NM_000027.3:c.214T>C, NM_000027.3:c.302C>T, NM_000027.3:c.800dupT, NM_000027.3:c.904G>A600
AGLGlycogen storage disease type 3NM_000642.2NM_000642.2:c.1783C>T, NM_000642.2:c.18_19delGA, NM_000642.2:c.112A>G, NM_000642.2:c.1222C>T, NM_000642.2:c.1481G>A, NM_000642.2:c.1485delT, NM_000642.2:c.16C>T, NM_000642.2:c.4260-1G>T, NM_000642.2:c.3214_3215delGA, NM_000642.2:c.1999delC, NM_000642.2:c.2039G>A, NM_000642.2:c.2590C>T, NM_000642.2:c.4456delT, NM_000642.2:c.3216_3217delGA, NM_000642.2:c.3980G>A, NM_000642.2:c.4342G>C, NM_000642.2:c.4529dupA, NM_000642.2:c.294-2A>T, NM_000642.2:c.4260-12A>G250,600
AGPSRhizomelic chondrodysplasia punctata type 3NM_003659.3NM_003659.3:c.1256G>A, NM_003659.3:c.926C>T, NM_003659.3:c.1406T>C, NM_003659.3:c.1703C>T600
AGTRenal tubular dysgenesisNM_000029.3NM_000029.3:c.1124G>A, NM_000029.3:c.604C>T, NM_000029.3:c.1290_1291insT, NM_000029.3:c.1290delT600
AGTR1Renal tubular dysgenesisNM_031850.3NM_031850.3:c.481delC, NM_031850.3:c.259dupG, NM_031850.3:c.215dupT, NM_031850.3:c.481C>T600
AGXTPrimary hyperoxaluria type 1NM_000030.2NM_000030.2:c.166-2A>G, NM_000030.2:c.121G>A, NM_000030.2:c.32C>A, NM_000030.2:c.245G>A, NM_000030.2:c.25_26insC, NM_000030.2:c.322T>C, NM_000030.2:c.508G>A, NM_000030.2:c.560C>T, NM_000030.2:c.590G>A, NM_000030.2:c.613T>C, NM_000030.2:c.697C>T, NM_000030.2:c.698G>A, NM_000030.2:c.731T>C, NM_000030.2:c.738G>A, NM_000030.2:c.836T>C, NM_000030.2:c.860G>A, NM_000030.2:c.33_34insC, NM_000030.2:c.454T>A, NM_000030.2:c.466G>A, NM_000030.2:c.248A>G250,600
AHI1Joubert syndrome type 3NM_017651.4NM_017651.4:c.1303C>T, NM_017651.4:c.1484G>A, NM_017651.4:c.2295_2296insA, NM_017651.4:c.2295dupA, NM_017651.4:c.3257A>G, NM_017651.4:c.2168G>A, NM_017651.4:c.985C>T, NM_017651.4:c.989A>G, NM_017651.4:c.3263_3264delGG, NM_017651.4:c.1051C>T, NM_017651.4:c.1052G>T250,600
AIPL1Cone-rod dystrophyNM_014336.4NM_014336.4:c.1053_1064delTGCAGAGCCACC250,600
AIPL1Leber congenital amaurosis type 4NM_014336.4NM_014336.4:c.905G>T, NM_014336.4:c.834G>A, NM_014336.4:c.589G>C, NM_014336.4:c.715T>C250,600
ALAS2Erythropoietic protoporphyriaNM_000032.4NM_000032.4:c.1699_1700delAT, NM_000032.4:c.1706_1709delAGTG600
ALAS2Sideroblastic anemia, X-linkedNM_000032.4NM_000032.4:c.1354C>T600
ALDH4A1Hyperprolinemia type 2NM_003748.3NM_003748.3:c.1055C>T600
ALDH5A1Succinic semialdehyde dehydrogenase deficiencyNM_001080.3NM_001080.3:c.1234C>T, NM_001080.3:c.1226G>A, NM_001080.3:c.901A>G, NM_001080.3:c.1540C>T, NM_001080.3:c.1579C>T, NM_001080.3:c.612G>A, NM_001080.3:c.803G>A, NM_001080.3:c.862A>G600
ALDOAGlycogen storage disease type 12NM_000034.3NM_000034.3:c.619G>A, NM_000034.3:c.386A>G600
ALDOBHereditary fructose intoleranceNM_000035.3NM_000035.3:c.1005C>G, NM_000035.3:c.178C>T, NM_000035.3:c.1027T>C, NM_000035.3:c.10C>T, NM_000035.3:c.136A>T, NM_000035.3:c.448G>C, NM_000035.3:c.2T>C, NM_000035.3:c.360_363delCAAA, NM_000035.3:c.442T>C, NM_000035.3:c.1013C>T, NM_000035.3:c.113-1_115delGGTA, NM_000035.3:c.1067C>A, NM_000035.3:c.612T>A, NM_000035.3:c.720C>A, NM_000035.3:c.524C>A250,600
ALG1Congenital disorders of glycosylation type 1kNM_019109.4NM_019109.4:c.1187+1G>A, NM_019109.4:c.1079C>T, NM_019109.4:c.1129A>G, NM_019109.4:c.434G>A, NM_019109.4:c.450C>G, NM_019109.4:c.773C>T600
ALG6Congenital disorders of glycosylation type IcNM_013339.3NM_013339.3:c.897_899delAAT, NM_013339.3:c.998C>T, NM_013339.3:c.495-3C>G, NM_013339.3:c.53G>A, NM_013339.3:c.316C>T, NM_013339.3:c.482A>G, NM_013339.3:c.1432T>C250,600
ALMS1Alström syndromeNM_015120.4NM_015120.4:c.11443C>T, NM_015120.4:c.10775delC, NM_015120.4:c.11316_11319delAGAG, NM_015120.4:c.2323C>T, NM_015120.4:c.11449C>T, NM_015120.4:c.11452_11453insA, NM_015120.4:c.1574_1576delCTCinsT, NM_015120.4:c.8383C>T, NM_015120.4:c.9612_9616delAACAG, NM_015120.4:c.10579_10580delAT, NM_015120.4:c.11610_11611delCT, NM_015120.4:c.12439C>T, NM_015120.4:c.12445C>T, NM_015120.4:c.891_907delTCAGCACCCGCTTATAG, NM_015120.4:c.9911-1G>A, NM_015120.4:c.11618_11619delCT, NM_015120.4:c.4245delC, NM_015120.4:c.5584C>T, NM_015120.4:c.8164C>T250,600
ALPLHypophosphatasiaNM_000478.4NM_000478.4:c.1001G>A, NM_000478.4:c.1366G>A, NM_000478.4:c.211C>T, NM_000478.4:c.212G>C, NM_000478.4:c.323C>T, NM_000478.4:c.346G>A, NM_000478.4:c.407G>A, NM_000478.4:c.526G>A, NM_000478.4:c.535G>A, NM_000478.4:c.571G>A, NM_000478.4:c.620A>C, NM_000478.4:c.1133A>T, NM_000478.4:c.1250A>G, NM_000478.4:c.1306T>C, NM_000478.4:c.98C>T, NM_000478.4:c.1574delG, NM_000478.4:c.892G>A, NM_000478.4:c.814C>T, NM_000478.4:c.881A>C600
AMACRAlpha-methylacyl-CoA racemase deficiencyNM_014324.5NM_014324.5:c.857delT, NM_014324.5:c.320T>C, NM_014324.5:c.43delG, NM_014324.5:c.154T>C600
AMTGlycine encephalopathyNM_000481.3NM_000481.3:c.139G>A, NM_000481.3:c.125A>G, NM_000481.3:c.959G>A, NM_000481.3:c.574C>T, NM_000481.3:c.806G>A, NM_000481.3:c.826G>C, NM_000481.3:c.259-1G>C600
ANO5Limb-girdle muscular dystrophy type 2L, autosomal recessiveNM_213599.2NM_213599.2:c.155A>G, NM_213599.2:c.1622_1623insA, NM_213599.2:c.1407+5G>A, NM_213599.2:c.1887delA, NM_213599.2:c.1733T>C, NM_213599.2:c.692G>T, NM_213599.2:c.1627_1628insA, NM_213599.2:c.172C>T, NM_213599.2:c.206_207delAT, NM_213599.2:c.1210C>T, NM_213599.2:c.1295C>G, NM_213599.2:c.1914G>A, NM_213599.2:c.184_185insA, NM_213599.2:c.1898+1G>A, NM_213599.2:c.191_192insA250,600
APTXAtaxia with oculomotor apraxia type 1NM_175073.2NM_175073.2:c.167delT, NM_175073.2:c.788T>G, NM_175073.2:c.320delC, NM_175073.2:c.617C>T, NM_175073.2:c.659C>T, NM_175073.2:c.134-2A>G, NM_175073.2:c.166C>T, NM_175073.2:c.124C>T, NM_175073.2:c.875-1G>A, NM_175073.2:c.837G>A, NM_175073.2:c.596G>A250,600
ARAndrogen insensitivity syndromeNM_000044.3NM_000044.3:c.2650A>T, NM_000044.3:c.340C>T, NM_000044.3:c.1937C>A, NM_000044.3:c.2323C>T, NM_000044.3:c.2391G>A, NM_000044.3:c.2567G>A, NM_000044.3:c.1769-11T>A, NM_000044.3:c.1771A>T, NM_000044.3:c.2395C>G250,600
ARG1ArgininemiaNM_000045.3NM_000045.3:c.61C>T, NM_000045.3:c.365G>A, NM_000045.3:c.413G>T, NM_000045.3:c.871C>T, NM_000045.3:c.32T>C, NM_000045.3:c.703G>C, NM_000045.3:c.869C>G600
ARL13BJoubert syndrome type 8NM_182896.2NM_182896.2:c.1186C>G, NM_182896.2:c.246G>A, NM_182896.2:c.1252C>T, NM_182896.2:c.598C>T600
ARL6Bardet-Biedl syndrome type 3NM_177976.2NM_177976.2:c.4G>T, NM_177976.2:c.92C>G, NM_177976.2:c.281T>C, NM_177976.2:c.92C>T, NM_177976.2:c.431C>T, NM_177976.2:c.364C>T600
ARL6Retinitis pigmentosa type 55NM_177976.2NM_177976.2:c.266C>T600
ARSAMetachromatic leukodystrophyNM_000487.5NM_000487.5:c.1241delC, NM_000487.5:c.1283C>T, NM_000487.5:c.346C>T, NM_000487.5:c.34delG, NM_000487.5:c.1210+1G>A, NM_000487.5:c.1232C>T, NM_000487.5:c.582delC, NM_000487.5:c.583delT, NM_000487.5:c.542dupT, NM_000487.5:c.542T>G, NM_000487.5:c.1408_1418delGCAGCTGTGAC, NM_000487.5:c.195delC, NM_000487.5:c.641C>T, NM_000487.5:c.1401_1411delGTTAGACGCAG, NM_000487.5:c.869G>A, NM_000487.5:c.869G>T, NM_000487.5:c.883G>A, NM_000487.5:c.899T>C, NM_000487.5:c.931G>A, NM_000487.5:c.937C>T, NM_000487.5:c.938G>A, NM_000487.5:c.979G>A, NM_000487.5:c.737G>A, NM_000487.5:c.739G>A, NM_000487.5:c.763G>A, NM_000487.5:c.827C>T, NM_000487.5:c.854+1G>A, NM_000487.5:c.1108-2A>G, NM_000487.5:c.1125_1126delCT, NM_000487.5:c.1150G>A, NM_000487.5:c.1174C>T, NM_000487.5:c.1175G>A, NM_000487.5:c.986C>T, NM_000487.5:c.991G>T, NM_000487.5:c.465+1G>A, NM_000487.5:c.257G>A, NM_000487.5:c.293C>T, NM_000487.5:c.302G>A250,600
ARSBMucopolysaccharidosis type 6NM_000046.3NM_000046.3:c.410G>T, NM_000046.3:c.427delG, NM_000046.3:c.349T>C, NM_000046.3:c.389C>T, NM_000046.3:c.937C>G, NM_000046.3:c.944G>A, NM_000046.3:c.971G>T, NM_000046.3:c.979C>T, NM_000046.3:c.1562G>A, NM_000046.3:c.629A>G, NM_000046.3:c.1143-1G>C, NM_000046.3:c.571C>T, NM_000046.3:c.589C>T, NM_000046.3:c.1178A>C, NM_000046.3:c.1214G>A, NM_000046.3:c.1143-8T>G, NM_000046.3:c.1161dupC, NM_000046.3:c.707T>C, NM_000046.3:c.753C>G, NM_000046.3:c.1366C>T, NM_000046.3:c.1438_1439insG, NM_000046.3:c.921delA250,600
ARSEChondrodysplasia punctata type 1, X-linkedNM_000047.2NM_000047.2:c.119T>G, NM_000047.2:c.1429delG, NM_000047.2:c.1442C>T, NM_000047.2:c.1732C>T, NM_000047.2:c.1743G>A, NM_000047.2:c.24-1G>A, NM_000047.2:c.410G>C, NM_000047.2:c.410G>T250,600
ARXEpileptic encephalopathy, early infantile, type 1NM_139058.2NM_139058.2:c.1058C>T600
ARXLissencephaly with abnormal genitalia, X-linkedNM_139058.2NM_139058.2:c.980_983delAACA600
ASLArgininosuccinic aciduriaNM_000048.3NM_000048.3:c.1135C>T, NM_000048.3:c.1060C>T, NM_000048.3:c.1255_1256delCT, NM_000048.3:c.1366C>T, NM_000048.3:c.1045_1057delGTCATCTCTACGC, NM_000048.3:c.578G>A, NM_000048.3:c.539T>G, NM_000048.3:c.544C>T, NM_000048.3:c.557G>A, NM_000048.3:c.1144-2A>G, NM_000048.3:c.602+1G>A, NM_000048.3:c.857A>G, NM_000048.3:c.925G>A, NM_000048.3:c.446+1G>A, NM_000048.3:c.505T>C, NM_000048.3:c.525-2A>T, NM_000048.3:c.532G>A, NM_000048.3:c.337C>T, NM_000048.3:c.346C>T, NM_000048.3:c.35G>A, NM_000048.3:c.1369dupG, NM_000048.3:c.437G>A, NM_000048.3:c.392C>T, NM_000048.3:c.1153C>T250,600
ASPACanavan diseaseNM_000049.2NM_000049.2:c.838C>T, NM_000049.2:c.693C>A, NM_000049.2:c.654C>A, NM_000049.2:c.433-2A>G, NM_000049.2:c.854A>C, NM_000049.2:c.914C>A, NM_000049.2:c.212G>A, NM_000049.2:c.863A>G250,600
ASPMMicrocephaly primary, type 5, autosomal recessiveNM_018136.4NM_018136.4:c.1002delA, NM_018136.4:c.3055C>T, NM_018136.4:c.2389C>T, NM_018136.4:c.2967G>A, NM_018136.4:c.1260_1266delTCAAGTC, NM_018136.4:c.10059C>A, NM_018136.4:c.1154_1155delAG, NM_018136.4:c.1179delT, NM_018136.4:c.1729_1730delAG, NM_018136.4:c.1959_1962delCAAA, NM_018136.4:c.1990C>T, NM_018136.4:c.3979C>T, NM_018136.4:c.4195dupA, NM_018136.4:c.4583delA, NM_018136.4:c.4795C>T, NM_018136.4:c.4858_4859delAT, NM_018136.4:c.5136C>A, NM_018136.4:c.5149delA, NM_018136.4:c.1366G>T, NM_018136.4:c.1406_1413delATCCTAAA, NM_018136.4:c.1590delA, NM_018136.4:c.6189T>G, NM_018136.4:c.6232C>T, NM_018136.4:c.6337_6338delAT, NM_018136.4:c.6732delA, NM_018136.4:c.719_720delCT, NM_018136.4:c.7491_7495delTATTA, NM_018136.4:c.7565T>G, NM_018136.4:c.7761T>G, NM_018136.4:c.7782_7783delGA, NM_018136.4:c.7860_7861delGA, NM_018136.4:c.7894C>T, NM_018136.4:c.8131_8132delAA, NM_018136.4:c.8230_8231insA, NM_018136.4:c.8378delT, NM_018136.4:c.8508_8509delGA, NM_018136.4:c.8668C>T, NM_018136.4:c.8844delC, NM_018136.4:c.9115_9118dupCATT, NM_018136.4:c.9159delA, NM_018136.4:c.9178C>T, NM_018136.4:c.3082G>A, NM_018136.4:c.3188T>G, NM_018136.4:c.3477_3481delCGCTA, NM_018136.4:c.349C>T, NM_018136.4:c.3527C>G, NM_018136.4:c.3663delG, NM_018136.4:c.3710C>G, NM_018136.4:c.3796G>T, NM_018136.4:c.3811C>T, NM_018136.4:c.3978G>A, NM_018136.4:c.9747_9748delCT, NM_018136.4:c.9754delA, NM_018136.4:c.9789T>A, NM_018136.4:c.8711_8712delAA, NM_018136.4:c.9190C>T, NM_018136.4:c.9238A>T, NM_018136.4:c.9319C>T, NM_018136.4:c.5439_5440delAG, NM_018136.4:c.577C>T, NM_018136.4:c.6073delG, NM_018136.4:c.9677dupG, NM_018136.4:c.9685delA, NM_018136.4:c.9697C>T, NM_018136.4:c.9730C>T, NM_018136.4:c.9557C>G, NM_018136.4:c.9492T>G, NM_018136.4:c.9539A>C250,600
ASS1Citrullinemia type 1NM_000050.4NM_000050.4:c.421-2A>G, NM_000050.4:c.40G>A, NM_000050.4:c.1088G>A, NM_000050.4:c.470G>A, NM_000050.4:c.1085G>T, NM_000050.4:c.1087C>T, NM_000050.4:c.257G>A, NM_000050.4:c.323G>T, NM_000050.4:c.349G>A, NM_000050.4:c.380G>A, NM_000050.4:c.836G>A, NM_000050.4:c.910C>T, NM_000050.4:c.928A>C, NM_000050.4:c.496-2A>G, NM_000050.4:c.535T>C, NM_000050.4:c.539G>A, NM_000050.4:c.53C>T, NM_000050.4:c.571G>A, NM_000050.4:c.787G>A, NM_000050.4:c.793C>T, NM_000050.4:c.794G>A, NM_000050.4:c.805G>A, NM_000050.4:c.835C>T, NM_000050.4:c.919C>T, NM_000050.4:c.970G>A, NM_000050.4:c.814C>T, NM_000050.4:c.970+5G>A, NM_000050.4:c.1168G>A, NM_000050.4:c.1194-1G>C, NM_000050.4:c.256C>T250,600
ATICAICA-ribosiduriaNM_004044.6NM_004044.6:c.223+1G>A, NM_004044.6:c.1277A>G, NM_004044.6:c.625delG250,600
ATP7AMenkes diseaseNM_000052.6NM_000052.6:c.2938C>T, NM_000052.6:c.2531G>A, NM_000052.6:c.1639C>T, NM_000052.6:c.1974_1977dupGTTT, NM_000052.6:c.3257_3258delAC, NM_000052.6:c.3294+2T>G, NM_000052.6:c.3915_3921delCTCCCCA, NM_000052.6:c.3931A>G600
ATP7AOccipital horn syndromeNM_000052.6NM_000052.6:c.3911A>G600
ATP7ASpinal muscular atrophy, distal, X-linkedNM_000052.6NM_000052.6:c.2981C>T600
ATP7BWilson diseaseNM_000053.3NM_000053.3:c.2532delA, NM_000053.3:c.2356-2A>G, NM_000053.3:c.1285+5G>T, NM_000053.3:c.2305A>G, NM_000053.3:c.1145_1151delCCCAACT, NM_000053.3:c.1934T>G, NM_000053.3:c.2071G>A, NM_000053.3:c.2297C>G, NM_000053.3:c.2972C>T, NM_000053.3:c.2975C>T, NM_000053.3:c.3083delA, NM_000053.3:c.2605G>A, NM_000053.3:c.2621C>T, NM_000053.3:c.2755C>G, NM_000053.3:c.2755C>T, NM_000053.3:c.2762G>A, NM_000053.3:c.2795C>A, NM_000053.3:c.2804C>T, NM_000053.3:c.2807T>A, NM_000053.3:c.2906G>A, NM_000053.3:c.2930C>T, NM_000053.3:c.4301C>T, NM_000053.3:c.915T>A, NM_000053.3:c.98T>C, NM_000053.3:c.1745_1746delTA, NM_000053.3:c.2123T>C, NM_000053.3:c.2267C>T, NM_000053.3:c.4088C>T, NM_000053.3:c.4135C>T, NM_000053.3:c.1512_1513insT, NM_000053.3:c.19_20delCA, NM_000053.3:c.1922T>C, NM_000053.3:c.3955C>T, NM_000053.3:c.3990_3993delTTAT, NM_000053.3:c.4058G>A, NM_000053.3:c.3207C>A, NM_000053.3:c.3359T>A, NM_000053.3:c.3688A>G, NM_000053.3:c.3101A>G, NM_000053.3:c.3796G>A, NM_000053.3:c.3809A>G, NM_000053.3:c.562C>T, NM_000053.3:c.3694A>C, NM_000053.3:c.1846C>T250,600
ATRSeckel syndrome type 1NM_001184.3NM_001184.3:c.2341+1G>A, NM_001184.3:c.5645delA, NM_001184.3:c.6037_6038insA, NM_001184.3:c.6488delT, NM_001184.3:c.975_976delCT, NM_001184.3:c.5635G>T250,600
AUH3-Methylglutaconic aciduria type 1NM_001698.2NM_001698.2:c.471delT, NM_001698.2:c.559G>A, NM_001698.2:c.589C>T, NM_001698.2:c.650G>A, NM_001698.2:c.895-1G>A, NM_001698.2:c.991A>T, NM_001698.2:c.656-2A>G, NM_001698.2:c.943-2A>G600
B4GALT1Congenital disorders of glycosylation type 2dNM_001497.3NM_001497.3:c.1031dupC600
B9D2Meckel syndrome type 10NM_030578.3NM_030578.3:c.301A>C600
BCKDHAMaple syrup urine disease type 1ANM_000709.3NM_000709.3:c.1037G>A, NM_000709.3:c.1036C>T, NM_000709.3:c.1234G>A, NM_000709.3:c.14delT, NM_000709.3:c.761C>A, NM_000709.3:c.929C>G, NM_000709.3:c.964C>T, NM_000709.3:c.979G>A, NM_000709.3:c.905A>C, NM_000709.3:c.632C>T, NM_000709.3:c.659C>T, NM_000709.3:c.740_741insT, NM_000709.3:c.868G>A, NM_000709.3:c.909_910delGT, NM_000709.3:c.917delT, NM_000709.3:c.853G>C, NM_000709.3:c.796delA250,600
BCKDHBMaple syrup urine disease type 1BNM_183050.2NM_183050.2:c.1046G>A, NM_183050.2:c.547C>T, NM_183050.2:c.509G>A, NM_183050.2:c.526A>T, NM_183050.2:c.344-1G>A, NM_183050.2:c.1114G>T, NM_183050.2:c.302G>A, NM_183050.2:c.342T>G, NM_183050.2:c.508C>A, NM_183050.2:c.508C>G, NM_183050.2:c.508C>T, NM_183050.2:c.748G>T, NM_183050.2:c.752T>C, NM_183050.2:c.799C>T, NM_183050.2:c.548G>C, NM_183050.2:c.884delT, NM_183050.2:c.902T>G, NM_183050.2:c.952-1G>A, NM_183050.2:c.853C>T, NM_183050.2:c.832G>A, NM_183050.2:c.356T>G, NM_183050.2:c.970C>T, NM_183050.2:c.488A>T, NM_183050.2:c.479T>G600
BCS1LBjörnstad syndromeNM_004328.4NM_004328.4:c.548G>A250,600
BCS1LGRACILE syndromeNM_004328.4NM_004328.4:c.232A>G250,600
BCS1LMitochondrial comlpex III deficiency, nuclear type 1NM_004328.4NM_004328.4:c.1057G>A, NM_004328.4:c.830G>A, NM_004328.4:c.133C>T, NM_004328.4:c.103G>C, NM_004328.4:c.696delT, NM_004328.4:c.148A>G, NM_004328.4:c.166C>T, NM_004328.4:c.550C>T, NM_004328.4:c.547C>T250,600
BEST1BestrophinopathyNM_004183.3NM_004183.3:c.934G>A, NM_004183.3:c.598C>T, NM_004183.3:c.752G>A, NM_004183.3:c.949G>A, NM_004183.3:c.521_522delTG250,600
BEST1Retinitis pigmentosa type 50NM_004183.3NM_004183.3:c.1383_1384insGCCTTGATGGA, NM_004183.3:c.1444delG, NM_004183.3:c.1491_1497dupCAAAGAC, NM_004183.3:c.1566_1576dupCTTGATGGAGC, NM_004183.3:c.341_342delTG, NM_004183.3:c.1308_1309insACCAAAG, NM_004183.3:c.1264delG, NM_004183.3:c.418C>G, NM_004183.3:c.614T>C, NM_004183.3:c.682G>A, NM_004183.3:c.344delG, NM_004183.3:c.524delG250,600
BEST1Vitelliform macular dystrophy type 2NM_004183.3NM_004183.3:c.122T>C, NM_004183.3:c.422G>A250,600
BRCA2Fanconi anemia, complementation group D1NM_000059.3NM_000059.3:c.1514T>C, NM_000059.3:c.4648G>T, NM_000059.3:c.8415A>T, NM_000059.3:c.7544C>T, NM_000059.3:c.7994A>G, NM_000059.3:c.5574_5577delAATT, NM_000059.3:c.4889C>G, NM_000059.3:c.4936_4939delGAAA, NM_000059.3:c.5066_5067insA, NM_000059.3:c.6024dupG, NM_000059.3:c.6860delG, NM_000059.3:c.7235C>A, NM_000059.3:c.9382C>T, NM_000059.3:c.9900dupA, NM_000059.3:c.3847_3848delGT, NM_000059.3:c.5718_5719delCT, NM_000059.3:c.5837_5838delCAinsAG, NM_000059.3:c.6023_6024insG, NM_000059.3:c.8503T>C, NM_000059.3:c.6486_6489delACAA, NM_000059.3:c.657_658delTG, NM_000059.3:c.6997_6998insT250,600
BRIP1Fanconi anemia, complementation group JNM_032043.2NM_032043.2:c.2990_2993delCAAA, NM_032043.2:c.1045G>C, NM_032043.2:c.2237_2240delTCAA, NM_032043.2:c.3209C>A, NM_032043.2:c.502C>T, NM_032043.2:c.139C>G, NM_032043.2:c.1702_1703delAA, NM_032043.2:c.2392C>T250,600
BSCL2Berardinelli-Seip congenital lipodystrophyNM_032667.6NM_032667.6:c.634G>C, NM_032667.6:c.412C>T, NM_032667.6:c.782_783insG, NM_032667.6:c.823C>T, NM_032667.6:c.985C>T, NM_032667.6:c.672-3C>G, NM_032667.6:c.974_975insG, NM_032667.6:c.671+5G>A600
BSCL2Severe neurodegenerative syndrome with lipodystrophyNM_032667.6NM_032667.6:c.793C>T600
BSNDBartter syndrome type 4ANM_057176.2NM_057176.2:c.1A>T, NM_057176.2:c.22C>T, NM_057176.2:c.3G>A, NM_057176.2:c.10G>T, NM_057176.2:c.23G>T, NM_057176.2:c.35T>C, NM_057176.2:c.23G>A, NM_057176.2:c.139G>A250,600
BTDBiotinidase deficiencyNM_000060.3NM_000060.3:c.1531C>G, NM_000060.3:c.1508_1512delGGATG, NM_000060.3:c.1339C>T, NM_000060.3:c.1352G>A, NM_000060.3:c.1489C>T, NM_000060.3:c.643C>T, NM_000060.3:c.664G>A, NM_000060.3:c.755A>G, NM_000060.3:c.1368A>C, NM_000060.3:c.933delT, NM_000060.3:c.1595C>T, NM_000060.3:c.1612C>T, NM_000060.3:c.757C>T, NM_000060.3:c.1106C>T, NM_000060.3:c.1321delG, NM_000060.3:c.794A>T, NM_000060.3:c.595G>A, NM_000060.3:c.629A>G, NM_000060.3:c.631C>T, NM_000060.3:c.235C>T, NM_000060.3:c.334G>C, NM_000060.3:c.511G>A, NM_000060.3:c.184G>A, NM_000060.3:c.557G>A, NM_000060.3:c.583A>G, NM_000060.3:c.968A>G, NM_000060.3:c.528G>T, NM_000060.3:c.443G>A250,600
BTKAgammaglobulinemia, X-linkedNM_000061.2NM_000061.2:c.1275C>A, NM_000061.2:c.1506C>A, NM_000061.2:c.1125T>G, NM_000061.2:c.1223T>C, NM_000061.2:c.1288A>G, NM_000061.2:c.1082A>G, NM_000061.2:c.763C>T, NM_000061.2:c.1516T>C, NM_000061.2:c.718G>T, NM_000061.2:c.755G>A, NM_000061.2:c.1766A>G, NM_000061.2:c.1773C>A, NM_000061.2:c.1558C>T, NM_000061.2:c.1559G>A, NM_000061.2:c.1889T>A, NM_000061.2:c.1906G>T, NM_000061.2:c.338T>A, NM_000061.2:c.1820C>A, NM_000061.2:c.862C>T, NM_000061.2:c.919A>G, NM_000061.2:c.1838G>A, NM_000061.2:c.1001A>C600
C10orf2Infantile onset spinocerebellar ataxiaNM_021830.4NM_021830.4:c.1523A>G600
C10orf2Mitochondrial DNA depletion syndrome, hepatocerebrorenal formNM_021830.4NM_021830.4:c.1287C>T, NM_021830.4:c.952G>A, NM_021830.4:c.1370C>T, NM_021830.4:c.524_525insG600
C10orf2Sensory ataxic neuropathy - dysarthria - ophthalmoparesisNM_021830.4NM_021830.4:c.955A>G600
C3Atypical hemolytic-uremic syndrome with C3 anomalyNM_000064.2NM_000064.2:c.2562C>G600
C3C3 deficiencyNM_000064.2NM_000064.2:c.2354+1G>A, NM_000064.2:c.4851-1G>A, NM_000064.2:c.1119+1G>T, NM_000064.2:c.3116dupT, NM_000064.2:c.3627_3628insGGGGCCC, NM_000064.2:c.1004-2A>T600
CA2Osteopetrosis, autosomal recessive, type 3NM_000067.2NM_000067.2:c.663+2T>C, NM_000067.2:c.319C>T, NM_000067.2:c.120T>G600
CAPN3Limb-girdle muscular dystrophy type 2ANM_000070.2NM_000070.2:c.1838delA, NM_000070.2:c.2120A>G, NM_000070.2:c.1795_1796insA, NM_000070.2:c.1469G>A, NM_000070.2:c.1599_1602delGAGC, NM_000070.2:c.1715G>A, NM_000070.2:c.1743_1745+1delTGAG, NM_000070.2:c.257C>T, NM_000070.2:c.328C>T, NM_000070.2:c.549delA, NM_000070.2:c.2212C>T, NM_000070.2:c.223dupT, NM_000070.2:c.2243G>A, NM_000070.2:c.2251_2254dupGTCA, NM_000070.2:c.2257G>A, NM_000070.2:c.2306G>A, NM_000070.2:c.2361_2363delAGinsTCATCT, NM_000070.2:c.2361_2364delAGinsTCATCT, NM_000070.2:c.2362_2363delAGinsTCATCT, NM_000070.2:c.246G>A, NM_000070.2:c.676G>A, NM_000070.2:c.551C>T, NM_000070.2:c.580delT, NM_000070.2:c.133G>A, NM_000070.2:c.550delA, NM_000070.2:c.1468C>T, NM_000070.2:c.956C>T, NM_000070.2:c.1322delG, NM_000070.2:c.1466G>A, NM_000070.2:c.662G>T, NM_000070.2:c.855_864dupGTTGATTGCA, NM_000070.2:c.1610A>G, NM_000070.2:c.598_612delTTCTGGAGTGCTCTG250,600
CBSHomocystinuriaNM_000071.2NM_000071.2:c.1150A>G, NM_000071.2:c.1058C>T, NM_000071.2:c.1136G>A, NM_000071.2:c.341C>T, NM_000071.2:c.1006C>T, NM_000071.2:c.325T>C, NM_000071.2:c.1316G>A, NM_000071.2:c.374G>A, NM_000071.2:c.1265C>T, NM_000071.2:c.1280C>T, NM_000071.2:c.146C>T, NM_000071.2:c.1471C>T, NM_000071.2:c.1616T>C, NM_000071.2:c.162G>A, NM_000071.2:c.833T>C, NM_000071.2:c.904G>A, NM_000071.2:c.919G>A, NM_000071.2:c.393G>C, NM_000071.2:c.415G>A, NM_000071.2:c.430G>A, NM_000071.2:c.434C>T, NM_000071.2:c.502G>A, NM_000071.2:c.526G>T, NM_000071.2:c.572C>T, NM_000071.2:c.676G>A, NM_000071.2:c.689delT, NM_000071.2:c.797G>A, NM_000071.2:c.959T>C, NM_000071.2:c.969G>A, NM_000071.2:c.992C>A, NM_000071.2:c.1330G>A, NM_000071.2:c.1379C>T, NM_000071.2:c.1397C>T, NM_000071.2:c.304A>C250,600
CC2D2AJoubert syndrome type 9NM_001080522.2NM_001080522.2:c.4179delG, NM_001080522.2:c.3594+1G>A, NM_001080522.2:c.3289delG, NM_001080522.2:c.4582C>T, NM_001080522.2:c.4667A>T, NM_001080522.2:c.2848C>T, NM_001080522.2:c.3364C>T, NM_001080522.2:c.4333C>T, NM_001080522.2:c.4181delG250,600
CC2D2AMeckel syndrome type 6NM_001080522.2NM_001080522.2:c.3145C>T, NM_001080522.2:c.2486+1G>C250,600
CD2APFocal segmental glomerulosclerosis type 3NM_012120.2NM_012120.2:c.730-1delGinsCT, NM_012120.2:c.1575_1577delAGA, NM_012120.2:c.1488G>A600
CD40LGHyper IgM syndrome, X-linkedNM_000074.2NM_000074.2:c.386A>G, NM_000074.2:c.368C>A, NM_000074.2:c.384T>A, NM_000074.2:c.632C>A, NM_000074.2:c.107T>G600
CDH23Deafness type 12, autosomal recessiveNM_022124.5NM_022124.5:c.6442G>A, NM_022124.5:c.5663T>C, NM_022124.5:c.9565C>T, NM_022124.5:c.7823G>A, NM_022124.5:c.902G>A250,600
CDH23Usher syndrome type 1DNM_022124.5NM_022124.5:c.288+1G>A, NM_022124.5:c.193delC, NM_022124.5:c.6050-9G>A, NM_022124.5:c.3141C>A, NM_022124.5:c.146-2A>G, NM_022124.5:c.4504C>T, NM_022124.5:c.3516_3519delATCC, NM_022124.5:c.3579+2T>C, NM_022124.5:c.3293A>G, NM_022124.5:c.9319+1_9319+4delGTAA, NM_022124.5:c.5237G>A, NM_022124.5:c.1858+2T>G, NM_022124.5:c.6392delC, NM_022124.5:c.7660G>A250,600
CDH3Ectodermal dysplasia - ectrodactyly - macular dystrophyNM_001793.4NM_001793.4:c.455_456insC, NM_001793.4:c.981delG, NM_001793.4:c.1508G>A, NM_001793.4:c.965A>T, NM_001793.4:c.830delG, NM_001793.4:c.965A>G600
CDHR1Retinitis pigmentosa type 65NM_033100.3NM_033100.3:c.1485+2T>C, NM_033100.3:c.1463delG, NM_033100.3:c.1110delC, NM_033100.3:c.338delG, NM_033100.3:c.524dupA, NM_033100.3:c.1485+2T>G, NM_033100.3:c.1112delC, NM_033100.3:c.640delG250,600
CDK5RAP2Microcephaly, primary, type 3, autosomal recessiveNM_018249.5NM_018249.5:c.4661_4662insTATT, NM_018249.5:c.246T>A, NM_018249.5:c.4546G>T, NM_018249.5:c.127+1G>C, NM_018249.5:c.4672C>T, NM_018249.5:c.524_528delAGGCA, NM_018249.5:c.700G>T600
CENPJMicrocephaly primary, type 6, autosomal recessiveNM_018451.4NM_018451.4:c.3243_3246delTCAG, NM_018451.4:c.2614delT, NM_018451.4:c.3415G>T, NM_018451.4:c.3653C>T, NM_018451.4:c.2462C>T, NM_018451.4:c.3699_3702dupAATA, NM_018451.4:c.3568_3571dupGTCA, NM_018451.4:c.3843_3844insTA, NM_018451.4:c.757_760delGTCT, NM_018451.4:c.1952_1953insAGTG, NM_018451.4:c.3704A>T, NM_018451.4:c.232_236delCAGAA, NM_018451.4:c.2460_2463delGACG, NM_018451.4:c.2968_2972delAAAAA, NM_018451.4:c.40C>T, NM_018451.4:c.289dupA250,600
CEP152Microcephaly, primary, type 9, autosomal recessiveNM_014985.3NM_014985.3:c.794A>C, NM_014985.3:c.749_750delGA600
CEP152Seckel syndrome type 5NM_014985.3NM_014985.3:c.2034T>G, NM_014985.3:c.1578-1G>A600
CEP290Joubert syndrome, Senior-Loken typeNM_025114.3NM_025114.3:c.5611_5614delCAAA, NM_025114.3:c.164_167delCTCA250,600
CEP290Joubert syndrome type 5NM_025114.3NM_025114.3:c.4656delA, NM_025114.3:c.21G>T, NM_025114.3:c.5668G>T250,600
CEP290Leber congenital amaurosis type 10NM_025114.3NM_025114.3:c.7341_7342insA, NM_025114.3:c.4705-1G>T, NM_025114.3:c.4723A>T, NM_025114.3:c.4962_4963delAA, NM_025114.3:c.4916C>A, NM_025114.3:c.6624delG, NM_025114.3:c.6645+1G>A, NM_025114.3:c.7324G>T, NM_025114.3:c.6798G>A, NM_025114.3:c.1681C>T, NM_025114.3:c.7341delA, NM_025114.3:c.6448_6455delCAGTTGAA, NM_025114.3:c.1665_1666delAA, NM_025114.3:c.384_387delTAGA, NM_025114.3:c.2249T>G, NM_025114.3:c.3185delT, NM_025114.3:c.4393C>T, NM_025114.3:c.1501G>T250,600
CEP290Meckel syndrome type 4NM_025114.3NM_025114.3:c.613C>T250,600
CERKLRetinitis pigmentosa tipo 26NM_201548.4NM_201548.4:c.1012C>T, NM_201548.4:c.1090C>T, NM_201548.4:c.312delA, NM_201548.4:c.715C>T, NM_201548.4:c.769C>T, NM_201548.4:c.780delT, NM_201548.4:c.847C>T, NM_201548.4:c.1553_1569dupTTATCAGTCTTTATGGA250,600
CFHComplement factor H deficiencyNM_000186.3NM_000186.3:c.3628C>T, NM_000186.3:c.2876G>A, NM_000186.3:c.380G>T, NM_000186.3:c.481G>T, NM_000186.3:c.1606T>C250,600
CFTRCystic fibrosisNM_000492.3NM_000492.3:c.1327_1330dupGATA, NM_000492.3:c.125C>T, NM_000492.3:c.1301_1307delCACTTCT, NM_000492.3:c.1397C>A, NM_000492.3:c.1340delA, NM_000492.3:c.1364C>A, NM_000492.3:c.1393-1G>A, NM_000492.3:c.1438G>T, NM_000492.3:c.1466C>A, NM_000492.3:c.1475C>T, NM_000492.3:c.1477C>T, NM_000492.3:c.1516A>G, NM_000492.3:c.1519_1521delATC, NM_000492.3:c.1521_1523delCTT, NM_000492.3:c.1545_1546delTA, NM_000492.3:c.1624G>T, NM_000492.3:c.1692delA, NM_000492.3:c.1706A>G, NM_000492.3:c.1721C>A, NM_000492.3:c.178G>T, NM_000492.3:c.1970delG, NM_000492.3:c.200C>T, NM_000492.3:c.2012delT, NM_000492.3:c.2051_2052delAAinsG, NM_000492.3:c.2052_2053insA, NM_000492.3:c.2052delA, NM_000492.3:c.1000C>T, NM_000492.3:c.1007T>A, NM_000492.3:c.1013C>T, NM_000492.3:c.1021T>C, NM_000492.3:c.1022_1023insTC, NM_000492.3:c.1040G>A, NM_000492.3:c.1040G>C, NM_000492.3:c.1055G>A, NM_000492.3:c.1081delT, NM_000492.3:c.115C>T, NM_000492.3:c.2538G>A, NM_000492.3:c.254G>A, NM_000492.3:c.2551C>T, NM_000492.3:c.2583delT, NM_000492.3:c.262_263delTT, NM_000492.3:c.2657+5G>A, NM_000492.3:c.2668C>T, NM_000492.3:c.273+1G>A, NM_000492.3:c.2737_2738insG, NM_000492.3:c.2739T>A, NM_000492.3:c.274-1G>A, NM_000492.3:c.274G>A, NM_000492.3:c.274G>T, NM_000492.3:c.2780T>C, NM_000492.3:c.2834C>T, NM_000492.3:c.2855T>C, NM_000492.3:c.2869_2870insG, NM_000492.3:c.2875delG, NM_000492.3:c.2908G>C, NM_000492.3:c.292C>T, NM_000492.3:c.2939T>A, NM_000492.3:c.2989-1G>A, NM_000492.3:c.3067_3072delATAGTG, NM_000492.3:c.3140-26A>G, NM_000492.3:c.3194T>C, NM_000492.3:c.3196C>T, NM_000492.3:c.3197G>A, NM_000492.3:c.3230T>C, NM_000492.3:c.325_327delTATinsG, NM_000492.3:c.3266G>A, NM_000492.3:c.3276C>A, NM_000492.3:c.3276C>G, NM_000492.3:c.328G>C, NM_000492.3:c.328G>T, NM_000492.3:c.3302T>A, NM_000492.3:c.3310G>T, NM_000492.3:c.349C>T, NM_000492.3:c.350G>T, NM_000492.3:c.3528delC, NM_000492.3:c.3533_3536delCAAC, NM_000492.3:c.3587C>G, NM_000492.3:c.358G>A, NM_000492.3:c.3611G>A, NM_000492.3:c.3612G>A, NM_000492.3:c.3659delC, NM_000492.3:c.366T>A, NM_000492.3:c.3731G>A, NM_000492.3:c.3744delA, NM_000492.3:c.3752G>A, NM_000492.3:c.3761T>G, NM_000492.3:c.3764C>A, NM_000492.3:c.3773_3774insT, NM_000492.3:c.3846G>A, NM_000492.3:c.3909C>G, NM_000492.3:c.3937C>T, NM_000492.3:c.4056G>T, NM_000492.3:c.4077_4080delinsAA, NM_000492.3:c.4077_4080delTGTTinsAA, NM_000492.3:c.4251delA, NM_000492.3:c.4333G>A, NM_000492.3:c.4426C>T, NM_000492.3:c.442delA, NM_000492.3:c.445G>A, NM_000492.3:c.445G>T, NM_000492.3:c.446G>T, NM_000492.3:c.531delT, NM_000492.3:c.532G>A, NM_000492.3:c.571T>G, NM_000492.3:c.577G>T, NM_000492.3:c.579+1G>T, NM_000492.3:c.579+3A>G, NM_000492.3:c.579+5G>A, NM_000492.3:c.592G>A, NM_000492.3:c.595C>T, NM_000492.3:c.613C>T, NM_000492.3:c.617T>G, NM_000492.3:c.650A>G, NM_000492.3:c.658C>T, NM_000492.3:c.708delT, NM_000492.3:c.722_743delGGAGAATGATGATGAAGTACAG, NM_000492.3:c.803delA, NM_000492.3:c.935_937delTCT, NM_000492.3:c.988G>T, NM_000492.3:c.1046C>T, NM_000492.3:c.14C>T, NM_000492.3:c.1558G>A, NM_000492.3:c.1585-1G>A, NM_000492.3:c.1684G>C, NM_000492.3:c.1766+1G>A, NM_000492.3:c.1397C>G, NM_000492.3:c.1399C>T, NM_000492.3:c.1400T>C, NM_000492.3:c.3380G>A, NM_000492.3:c.3409A>G, NM_000492.3:c.3868C>A, NM_000492.3:c.489+1G>T, NM_000492.3:c.2537G>A, NM_000492.3:c.2125C>T, NM_000492.3:c.2128A>T, NM_000492.3:c.2175_2176insA, NM_000492.3:c.2052dupA, NM_000492.3:c.2195T>G, NM_000492.3:c.2215delG, NM_000492.3:c.223C>T, NM_000492.3:c.2175dupA, NM_000492.3:c.221G>A, NM_000492.3:c.2930C>T, NM_000492.3:c.3205G>A, NM_000492.3:c.2249C>T250,600
CHST6Macular corneal dystrophyNM_021615.4NM_021615.4:c.820G>T, NM_021615.4:c.853delC, NM_021615.4:c.993G>T, NM_021615.4:c.327_328delCT, NM_021615.4:c.392C>A250,600
CLCN1Myotonia congenita, autosomal recessiveNM_000083.2NM_000083.2:c.1453A>G, NM_000083.2:c.409T>G, NM_000083.2:c.568G>A, NM_000083.2:c.899G>A, NM_000083.2:c.1169G>A, NM_000083.2:c.1238T>G, NM_000083.2:c.871G>A, NM_000083.2:c.180+3A>T, NM_000083.2:c.225dupC, NM_000083.2:c.501C>G, NM_000083.2:c.2680C>T250,600
CLCN7Osteopetrosis type 4, autosomal recessiveNM_001287.5NM_001287.5:c.622C>T, NM_001287.5:c.781A>T600
CLDN14Deafness type 29, autosomal recessiveNM_144492.2NM_144492.2:c.254T>A, NM_144492.2:c.301G>A, NM_144492.2:c.398delT600
CLDN19Hypomagnesemia type 5, renal failure with severe ocular abnormalitiesNM_148960.2NM_148960.2:c.269T>C, NM_148960.2:c.425_437delCCCTGGTGACCCA, NM_148960.2:c.59G>A, NM_148960.2:c.169C>G, NM_148960.2:c.599G>A250,600
CLN3Ceroid-lipofuscinoses neuronal type 3NM_001042432.1NM_001042432.1:c.883G>A, NM_001042432.1:c.597C>A, NM_001042432.1:c.622_623insT, NM_001042432.1:c.1272delG, NM_001042432.1:c.1210C>A600
CLN5Neuronal ceroid lipofuscinosis type 5NM_006493.2NM_006493.2:c.619T>C, NM_006493.2:c.335G>A, NM_006493.2:c.377G>A, NM_006493.2:c.620G>C, NM_006493.2:c.669dupC, NM_006493.2:c.335G>C, NM_006493.2:c.565C>T, NM_006493.2:c.575A>G, NM_006493.2:c.593T>C, NM_006493.2:c.595C>T, NM_006493.2:c.613C>T, NM_006493.2:c.919delA, NM_006493.2:c.924_925delAT, NM_006493.2:c.955_970delGGAAATGAAACATCTG, NM_006493.2:c.835G>A, NM_006493.2:c.526dupA, NM_006493.2:c.1026C>A, NM_006493.2:c.524T>G, NM_006493.2:c.433C>T600
CLN6Ceroid lipofuscinosis, neuronal, type 6NM_017882.2NM_017882.2:c.200T>C, NM_017882.2:c.214G>C, NM_017882.2:c.139C>T, NM_017882.2:c.307C>T, NM_017882.2:c.214G>T, NM_017882.2:c.663C>G600
CLN8Ceroid lipofuscinosis, neuronal, type 8NM_018941.3NM_018941.3:c.88delG, NM_018941.3:c.789G>C, NM_018941.3:c.610C>T, NM_018941.3:c.88G>C600
CLRN1Retinitis pigmentosa type 61NM_174878.2NM_174878.2:c.92C>T250,600
CLRN1Usher syndrome type 3ANM_174878.2NM_174878.2:c.591_592insT, NM_174878.2:c.630_631insT, NM_174878.2:c.118T>G, NM_174878.2:c.433+1061A>T, NM_174878.2:c.189C>A, NM_174878.2:c.144T>G250,600
CNGA1Retinitis pigmentosa type 49NM_000087.3NM_000087.3:c.1747C>T, NM_000087.3:c.1540C>T, NM_000087.3:c.2071T>C, NM_000087.3:c.1927C>T, NM_000087.3:c.1271G>A, NM_000087.3:c.1001G>A, NM_000087.3:c.959C>T, NM_000087.3:c.97_98insA, NM_000087.3:c.449+2T>C, NM_000087.3:c.1972delA, NM_000087.3:c.238G>T, NM_000087.3:c.794G>A, NM_000087.3:c.238G>A250,600
CNGB1Retinitis pigmentosa tipo 45NM_001297.4NM_001297.4:c.3150delG, NM_001297.4:c.2762_2765delACGA, NM_001297.4:c.2957A>T, NM_001297.4:c.413-1G>A, NM_001297.4:c.218-2A>G, NM_001297.4:c.2492+2T>G, NM_001297.4:c.3462+1G>A, NM_001297.4:c.2653delG, NM_001297.4:c.3425delT, NM_001297.4:c.1122-2A>T, NM_001297.4:c.1958-1G>A, NM_001297.4:c.952C>T250,600
CNGB3Achromatopsia type 3NM_019098.4NM_019098.4:c.2011G>T, NM_019098.4:c.1063C>T, NM_019098.4:c.1208G>A, NM_019098.4:c.1672G>T, NM_019098.4:c.819_826delCAGACTCC, NM_019098.4:c.1148delC, NM_019098.4:c.886_890delACTTC, NM_019098.4:c.2048_2049delCA, NM_019098.4:c.446_447insT, NM_019098.4:c.893_897delCAAAA, NM_019098.4:c.887_896delCTTCTACAAA250,600
CNGB3Macular degeneration, juvenileNM_019098.4NM_019098.4:c.1405T>G250,600
COL11A1Stickler syndrome type 2NM_001854.3NM_001854.3:c.1750dupG, NM_001854.3:c.2350G>C, NM_001854.3:c.4606C>G, NM_001854.3:c.4642C>G, NM_001854.3:c.3709-1G>A600
COL17A1Epidermolysis bullosa, junctional, non-Herlitz typeNM_000494.3NM_000494.3:c.1898G>A, NM_000494.3:c.3827_3828insC, NM_000494.3:c.2228-3_2235delCAGGTCCTGCTinsTTG, NM_000494.3:c.1706delC, NM_000494.3:c.2336-2A>G, NM_000494.3:c.3897_3900delATCT, NM_000494.3:c.3908G>A, NM_000494.3:c.2336-1G>T, NM_000494.3:c.2965delA, NM_000494.3:c.3043C>T, NM_000494.3:c.3067C>T, NM_000494.3:c.3277+1G>A, NM_000494.3:c.3676C>T, NM_000494.3:c.4319_4320insC, NM_000494.3:c.433C>T, NM_000494.3:c.520_521delAG, NM_000494.3:c.4003_4004delGG, NM_000494.3:c.2551+1G>T, NM_000494.3:c.3800delC, NM_000494.3:c.2564T>G, NM_000494.3:c.2430_2431insCCGA, NM_000494.3:c.2383C>T, NM_000494.3:c.2944_2947+1delGAAGG250,600
COL18A1Knobloch syndrome type 1NM_030582.3NM_030582.3:c.3367_3379delCCCCCAGGCCCAC, NM_030582.3:c.3493_3501delGGCCCCCCA, NM_030582.3:c.2797C>T, NM_030582.3:c.995_996insGACGTGAAAGAGGGG, NM_030582.3:c.3502_3511delGGCCCCCCAG, NM_030582.3:c.3618_3618+1delGG, NM_030582.3:c.994_995insGGACGTGAAAGAGGG, NM_030582.3:c.3517_3518delCC, NM_030582.3:c.1535_1536insGACGTGAAAGAGGGG, NM_030582.3:c.2589_2590delAG, NM_030582.3:c.4054_4055delCT, NM_030582.3:c.4463_4464insG250,600
COL1A2Ehlers-Danlos syndrome, cardiac valvular typeNM_000089.3NM_000089.3:c.3601G>T, NM_000089.3:c.1404+1G>A, NM_000089.3:c.559G>C, NM_000089.3:c.133-1G>A, NM_000089.3:c.1404+1G>C, NM_000089.3:c.240_247delGTATGATG, NM_000089.3:c.293_294insC600
COL2A1Otospondylomegaepiphyseal dysplasiaNM_001844.4NM_001844.4:c.1052delG, NM_001844.4:c.3106C>T600
COL4A3Alport syndrome, autosomal recessiveNM_000091.4NM_000091.4:c.345delG, NM_000091.4:c.346C>A, NM_000091.4:c.898G>A, NM_000091.4:c.4421T>C, NM_000091.4:c.2110delC, NM_000091.4:c.343delG, NM_000091.4:c.4420_4424delCTTTT, NM_000091.4:c.5002_*6delAAAAGACACTGAAGCTAA, NM_000091.4:c.2083G>A, NM_000091.4:c.2954G>T, NM_000091.4:c.4484A>G, NM_000091.4:c.4571C>G, NM_000091.4:c.4441C>T250,600
COL4A4Alport syndrome, autosomal recessiveNM_000092.4NM_000092.4:c.3713C>A, NM_000092.4:c.4129C>T, NM_000092.4:c.4923C>A, NM_000092.4:c.3601G>A, NM_000092.4:c.2312delG, NM_000092.4:c.71+1G>A250,600
COL7A1Epidermolysis bullosa dystrophica, Hallopeau-Siemens typeNM_000094.3NM_000094.3:c.4039G>C, NM_000094.3:c.425A>G, NM_000094.3:c.336C>G, NM_000094.3:c.3809C>T, NM_000094.3:c.4119+1G>T, NM_000094.3:c.6205C>T, NM_000094.3:c.6527_6528insC, NM_000094.3:c.6573+1G>T, NM_000094.3:c.6187C>T, NM_000094.3:c.6752G>A, NM_000094.3:c.6859G>A, NM_000094.3:c.6946G>A, NM_000094.3:c.6670G>T, NM_000094.3:c.1907G>T, NM_000094.3:c.2471_2472insG, NM_000094.3:c.7440+4delC, NM_000094.3:c.7912G>T, NM_000094.3:c.7930-1G>C, NM_000094.3:c.7957G>A, NM_000094.3:c.8245G>A, NM_000094.3:c.8371C>T, NM_000094.3:c.8393T>A, NM_000094.3:c.8440C>T, NM_000094.3:c.8479C>T, NM_000094.3:c.8524_8527+10delGAAGGTGAGGACAG, NM_000094.3:c.887delG, NM_000094.3:c.933C>A, NM_000094.3:c.238G>T, NM_000094.3:c.3831+1G>T, NM_000094.3:c.4373C>T, NM_000094.3:c.6091G>A, NM_000094.3:c.4888C>T, NM_000094.3:c.5052+1G>A, NM_000094.3:c.5096C>T, NM_000094.3:c.4783G>C, NM_000094.3:c.5443G>C, NM_000094.3:c.5532+1G>A, NM_000094.3:c.5821-1G>A, NM_000094.3:c.5287C>T, NM_000094.3:c.706C>T, NM_000094.3:c.7345-1G>A, NM_000094.3:c.592G>A, NM_000094.3:c.7411C>T250,600
COL9A1Stickler syndrome type 4NM_001851.4NM_001851.4:c.883C>T, NM_001851.4:c.706C>T600
COL9A2Stickler syndrome type 5NM_001852.3NM_001852.3:c.1918C>T, NM_001852.3:c.1097_1098insC, NM_001852.3:c.793-1G>C600
COQ2Primary coenzyme Q10 deficiency type 1NM_015697.7NM_015697.7:c.683A>G, NM_015697.7:c.1197delT, NM_015697.7:c.590G>A, NM_015697.7:c.723delT, NM_015697.7:c.890A>G250,600
CPS1Carbamoylphosphate synthetase type 1 deficiencyNM_001875.4NM_001875.4:c.1912C>T, NM_001875.4:c.697C>T, NM_001875.4:c.1631C>T, NM_001875.4:c.3556delA600
CPT1ACarnitine palmitoyltransferase type 1A deficiencyNM_001876.3NM_001876.3:c.1216C>T, NM_001876.3:c.1241C>T, NM_001876.3:c.1361A>G, NM_001876.3:c.222C>A, NM_001876.3:c.1079A>G, NM_001876.3:c.1436C>T, NM_001876.3:c.1493A>G, NM_001876.3:c.335_336delCC, NM_001876.3:c.1393G>T, NM_001876.3:c.281+1G>A, NM_001876.3:c.1538C>T, NM_001876.3:c.298C>T600
CPT2Carnitine palmitoyltransferase deficiency, type 2NM_000098.2NM_000098.2:c.1239_1240delGA, NM_000098.2:c.1369A>T, NM_000098.2:c.1237C>T, NM_000098.2:c.680C>T, NM_000098.2:c.1437C>G, NM_000098.2:c.149C>A, NM_000098.2:c.1784delC, NM_000098.2:c.886C>T, NM_000098.2:c.1763C>G, NM_000098.2:c.359A>G, NM_000098.2:c.370C>T, NM_000098.2:c.1883A>C, NM_000098.2:c.1891C>T, NM_000098.2:c.1148T>A, NM_000098.2:c.638A>G, NM_000098.2:c.725_726delAC, NM_000098.2:c.452G>A, NM_000098.2:c.338C>T, NM_000098.2:c.481C>T, NM_000098.2:c.464dupT, NM_000098.2:c.520G>A250,600
CRB1Leber congenital amaurosis type 8NM_201253.2NM_201253.2:c.3299T>G, NM_201253.2:c.3383delT, NM_201253.2:c.3419T>A, NM_201253.2:c.3094G>A, NM_201253.2:c.936T>G, NM_201253.2:c.493_501delGATGGAATT, NM_201253.2:c.3997G>T, NM_201253.2:c.498_506delAATTGATGG, NM_201253.2:c.2688T>A, NM_201253.2:c.613_619delATAGGAA, NM_201253.2:c.2401A>T, NM_201253.2:c.610_616delGAAATAG250,600
CRB1Pigmented paravenous chorioretinal atrophyNM_201253.2NM_201253.2:c.484G>A250,600
CRB1Retinitis pigmentosa type 12NM_201253.2NM_201253.2:c.3053_3054insTTATA, NM_201253.2:c.3122T>C, NM_201253.2:c.2416G>T, NM_201253.2:c.2843G>A, NM_201253.2:c.3299T>C, NM_201253.2:c.2983G>T, NM_201253.2:c.2290C>T250,600
CRLF1Cold-induced sweating syndromeNM_004750.4NM_004750.4:c.538C>T, NM_004750.4:c.303delC, NM_004750.4:c.413C>T, NM_004750.4:c.527+5G>A, NM_004750.4:c.226T>G, NM_004750.4:c.829C>T, NM_004750.4:c.397+1G>A, NM_004750.4:c.708_709delCCinsT, NM_004750.4:c.713_714insC, NM_004750.4:c.1125delG, NM_004750.4:c.676dupA, NM_004750.4:c.856-1G>A, NM_004750.4:c.852G>T, NM_004750.4:c.935G>A, NM_004750.4:c.1137C>G, NM_004750.4:c.845_846delTG600
CRTAPOsteogenesis imperfecta type 7NM_006371.4NM_006371.4:c.826C>T, NM_006371.4:c.180G>A, NM_006371.4:c.561T>G, NM_006371.4:c.634C>T600
CRXLeber congenital amaurosis type 7NM_000554.4NM_000554.4:c.425A>G, NM_000554.4:c.196G>A, NM_000554.4:c.898T>C250,600
CSTBProgressive myoclonic epilepsy type 1ANM_000100.3NM_000100.3:c.212A>C, NM_000100.3:c.202C>T600
CTNSCystinosis, ocular nonnephropathicNM_004937.2NM_004937.2:c.589G>A, NM_004937.2:c.853-3C>G250,600
CTNSNephropathic cystinosisNM_004937.2NM_004937.2:c.416C>T, NM_004937.2:c.414G>A, NM_004937.2:c.124G>A, NM_004937.2:c.357_360delCAGC, NM_004937.2:c.397_398delAT, NM_004937.2:c.1015G>A, NM_004937.2:c.646dupA, NM_004937.2:c.283G>T, NM_004937.2:c.329G>T, NM_004937.2:c.506G>A250,600
CTSDCeroid lipofuscinosis, neuronal, type 10NM_001909.4NM_001909.4:c.685T>A, NM_001909.4:c.1149G>C600
CTSKPycnodysostosisNM_000396.3NM_000396.3:c.236G>A, NM_000396.3:c.154A>T, NM_000396.3:c.436G>C, NM_000396.3:c.926T>C, NM_000396.3:c.721C>T250,600
CYP21A2Classic congenital adrenal hyperplasia due to 21-hydroxylase deficiency-hybrid 5'CYP21A1P/3'CYP21A2, hybrid 5'CYP21A2/3'CYP21A1P (Detection by MLPA)600
CYP21A2Classic congenital adrenal hyperplasia due to 21-hydroxylase deficiencyNM_000500.7NM_000500.7:c.518T>A, NM_000500.7:c.955C>T, NM_000500.7:c.1069C>T, NM_000500.7:c.719T>A, NM_000500.7:c.[713T>A;719T>A], NM_000500.7:c.293-13A/C>G, NM_000500.7:c.332_339del, NM_000500.7:c.[710T>A;719T>A], NM_000500.7:c.923_924insT, NM_000500.7:c.[710T>A;713T>A], NM_000500.7:c.713T>A, NM_000500.7:c.[710T>A;713T>A;719T>A], NM_000500.7:c.710T>A (Detection by minisequencing)600
CYP21A2Non-classic congenital adrenal hyperplasia due to 21-hydroxylase deficiencyNM_000500.7NM_000500.7:c.92C>T, NM_000500.7:c.844G>T, NM_000500.7:c.1360C>T (Detection by minisequencing)600
CYP4V2Bietti crystalline corneoretinal dystrophyNM_207352.3NM_207352.3:c.1523G>A, NM_207352.3:c.130T>A, NM_207352.3:c.327+1G>A, NM_207352.3:c.332T>C250,600
CYP7B1Congenital bile acid synthesis defect type 3NM_004820.3NM_004820.3:c.1162C>T250,600
CYP7B1Spastic paraplegia type 5A, autosomal recessiveNM_004820.3NM_004820.3:c.1460_1461insT, NM_004820.3:c.321_324delACAA, NM_004820.3:c.825T>A, NM_004820.3:c.889A>G, NM_004820.3:c.1456C>T, NM_004820.3:c.187C>T250,600
D2HGDHD-2-Hydroxyglutaric aciduriaNM_152783.4NM_152783.4:c.1315A>G, NM_152783.4:c.1276G>A, NM_152783.4:c.440T>G, NM_152783.4:c.1333_1334delAC, NM_152783.4:c.1123G>T, NM_152783.4:c.1331T>C250,600
DBTMaple syrup urine disease type 2NM_001918.3NM_001918.3:c.670G>T, NM_001918.3:c.827T>G, NM_001918.3:c.294C>G, NM_001918.3:c.581C>G, NM_001918.3:c.772+1G>A, NM_001918.3:c.272_275delCAGT, NM_001918.3:c.1281+1G>A, NM_001918.3:c.871C>T, NM_001918.3:c.901C>T, NM_001918.3:c.939G>C, NM_001918.3:c.126T>G250,600
DCLRE1COmenn syndromeNM_001033855.2NM_001033855.2:c.2T>C250,600
DCLRE1CSevere combined immunodeficiency due to DCLRE1C deficiencyNM_001033855.2NM_001033855.2:c.1558_1559insA, NM_001033855.2:c.597C>A, NM_001033855.2:c.780+1delG, NM_001033855.2:c.1639G>T, NM_001033855.2:c.1903_1904insA, NM_001033855.2:c.457G>A, NM_001033855.2:c.1559_1560insA250,600
DDB2Xeroderma pigmentosum complementation group ENM_000107.2NM_000107.2:c.730A>G, NM_000107.2:c.937C>T, NM_000107.2:c.818G>A, NM_000107.2:c.919G>T600
DDCAromatic L-amino acid decarboxylase deficiencyNM_000790.3NM_000790.3:c.100delG, NM_000790.3:c.1040G>A, NM_000790.3:c.823G>A, NM_000790.3:c.304G>A, NM_000790.3:c.272C>T, NM_000790.3:c.749C>T600
DFNB31Deafness type 31, autosomal recessiveNM_015404.3NM_015404.3:c.1135C>T, NM_015404.3:c.817C>T250,600
DFNB59Deafness type 59, autosomal recessiveNM_001042702.3NM_001042702.3:c.122delA, NM_001042702.3:c.420delT, NM_001042702.3:c.113dupT, NM_001042702.3:c.988delG, NM_001042702.3:c.726delT, NM_001042702.3:c.161C>T, NM_001042702.3:c.817_818insT600
DGUOKMitochondrial DNA depletion syndrome type 3NM_080916.2NM_080916.2:c.137A>G, NM_080916.2:c.707+2T>G, NM_080916.2:c.763G>T, NM_080916.2:c.425G>A, NM_080916.2:c.313C>T, NM_080916.2:c.494A>T250,600
DHCR7Smith-Lemli-Opitz syndromeNM_001360.2NM_001360.2:c.1055G>A, NM_001360.2:c.1210C>T, NM_001360.2:c.1054C>T, NM_001360.2:c.461C>G, NM_001360.2:c.151C>T, NM_001360.2:c.1031G>A, NM_001360.2:c.453G>A, NM_001360.2:c.506C>T, NM_001360.2:c.356A>T, NM_001360.2:c.1228G>A, NM_001360.2:c.1A>G, NM_001360.2:c.976G>T, NM_001360.2:c.964-1G>C, NM_001360.2:c.682C>T, NM_001360.2:c.452G>A, NM_001360.2:c.1337G>A, NM_001360.2:c.1342G>A, NM_001360.2:c.730G>A, NM_001360.2:c.292C>T, NM_001360.2:c.904T>C, NM_001360.2:c.907G>A, NM_001360.2:c.841G>A, NM_001360.2:c.744G>T, NM_001360.2:c.724C>T, NM_001360.2:c.725G>A, NM_001360.2:c.866C>T, NM_001360.2:c.278C>T, NM_001360.2:c.839A>G, NM_001360.2:c.832-1G>C250,600
DHDDSRetinitis pigmentosa type 59NM_024887.3NM_024887.3:c.328delA, NM_024887.3:c.998C>G, NM_024887.3:c.124A>G600
DKC1Dyskeratosis congenita, X-linkedNM_001363.4NM_001363.4:c.91C>A, NM_001363.4:c.214_215delCTinsTA, NM_001363.4:c.194G>C, NM_001363.4:c.838A>C, NM_001363.4:c.91C>G, NM_001363.4:c.196A>G600
DKC1Hoyeraal-Hreidarsson syndromeNM_001363.4NM_001363.4:c.200C>T, NM_001363.4:c.204C>A600
DLDDihydrolipoamide dehydrogenase deficiency E3NM_000108.4NM_000108.4:c.916_926delTGTGATGTACT, NM_000108.4:c.105_106insA, NM_000108.4:c.1483A>G600
DLL3Spondylocostal dysostosis type 1NM_016941.3NM_016941.3:c.231C>A, NM_016941.3:c.712C>T600
DMDBecker muscular dystrophyNM_004006.2NM_004006.2:c.3432+3A>G, NM_004006.2:c.3432+1G>A, NM_004006.2:c.137A>T600
DMDBecker muscular dystrophy-insBecker, delBecker (Detection by MLPA)600
DMDDilated cardiomyopathy type 3BNM_004006.2NM_004006.2:c.5922+3G>C600
DMDDuchenne muscular dystrophyNM_004006.2NM_004006.2:c.1261C>T, NM_004006.2:c.1286C>A, NM_004006.2:c.1070delC, NM_004006.2:c.10086+1G>A, NM_004006.2:c.1886C>A, NM_004006.2:c.1900A>T, NM_004006.2:c.10774delA, NM_004006.2:c.204dupC, NM_004006.2:c.1900_1903dupAAGT, NM_004006.2:c.10141C>T, NM_004006.2:c.10033C>T, NM_004006.2:c.10453_10454delCT, NM_004006.2:c.1012G>T, NM_004006.2:c.1048G>T, NM_004006.2:c.2302C>T, NM_004006.2:c.1734delA, NM_004006.2:c.2380+1G>C, NM_004006.2:c.2380+2T>C, NM_004006.2:c.2479delG, NM_004006.2:c.2482T>G, NM_004006.2:c.2484T>G, NM_004006.2:c.251delT, NM_004006.2:c.2523delA, NM_004006.2:c.10446_10447delCT, NM_004006.2:c.2650C>T, NM_004006.2:c.10454delT, NM_004006.2:c.2294_2297delCCAT, NM_004006.2:c.2803+1G>A, NM_004006.2:c.2803+1G>T, NM_004006.2:c.2804-1G>A, NM_004006.2:c.2804-2A>T, NM_004006.2:c.2815_2816delTT, NM_004006.2:c.1306dupG, NM_004006.2:c.1332-9A>G, NM_004006.2:c.133C>T, NM_004006.2:c.1341_1342dupAG, NM_004006.2:c.2547delT, NM_004006.2:c.1371delG, NM_004006.2:c.2755A>T, NM_004006.2:c.2758C>T, NM_004006.2:c.1529_1530delTC, NM_004006.2:c.160_162delCTC, NM_004006.2:c.3295C>T, NM_004006.2:c.6182delC, NM_004006.2:c.6226G>T, NM_004006.2:c.3639dupA, NM_004006.2:c.199G>T, NM_004006.2:c.3747delG, NM_004006.2:c.2125delC, NM_004006.2:c.137_138dupAT, NM_004006.2:c.4117C>T, NM_004006.2:c.412_413delAA, NM_004006.2:c.2281_2285delGAAAA, NM_004006.2:c.4375C>T, NM_004006.2:c.4405C>T, NM_004006.2:c.2332C>T, NM_004006.2:c.4471_4472delAA, NM_004006.2:c.4486delG, NM_004006.2:c.4500delA, NM_004006.2:c.4518+5G>A, NM_004006.2:c.4735G>T, NM_004006.2:c.4806A>T, NM_004006.2:c.4843A>T, NM_004006.2:c.489G>A, NM_004006.2:c.5287C>T, NM_004006.2:c.530+1delG, NM_004006.2:c.5313dupT, NM_004006.2:c.5353C>T, NM_004006.2:c.5363C>G, NM_004006.2:c.5530C>T, NM_004006.2:c.5554C>T, NM_004006.2:c.5570_5571dupAA, NM_004006.2:c.5640T>A, NM_004006.2:c.5671A>T, NM_004006.2:c.5697delA, NM_004006.2:c.5773G>T, NM_004006.2:c.5807T>A, NM_004006.2:c.583C>T, NM_004006.2:c.8944C>T, NM_004006.2:c.1489C>T, NM_004006.2:c.6000T>A, NM_004006.2:c.6014_6017delCTCA, NM_004006.2:c.615T>A, NM_004006.2:c.9346C>T, NM_004006.2:c.9361+1G>A, NM_004006.2:c.6238delC, NM_004006.2:c.3697delC, NM_004006.2:c.6292C>T, NM_004006.2:c.3779_3785delCTTTGGAinsGG, NM_004006.2:c.4071G>C, NM_004006.2:c.6391_6392delCA, NM_004006.2:c.6392_6393insCA, NM_004006.2:c.433C>T, NM_004006.2:c.676_678delAAG, NM_004006.2:c.6834delT, NM_004006.2:c.4409_4412dupGTCT, NM_004006.2:c.6936delA, NM_004006.2:c.6943G>T, NM_004006.2:c.6964delG, NM_004006.2:c.6982A>T, NM_004006.2:c.6986dupA, NM_004006.2:c.7682G>A, NM_004006.2:c.7683G>A, NM_004006.2:c.7764dupT, NM_004006.2:c.7771G>T, NM_004006.2:c.7894C>T, NM_004006.2:c.7922delA, NM_004006.2:c.8064_8065delTA, NM_004006.2:c.8069T>G, NM_004006.2:c.8086delC, NM_004006.2:c.8358G>A, NM_004006.2:c.8374_8375delAA, NM_004006.2:c.8443C>T, NM_004006.2:c.8464C>T, NM_004006.2:c.8608C>T, NM_004006.2:c.8652_8653delCT, NM_004006.2:c.8656C>T, NM_004006.2:c.8668G>A, NM_004006.2:c.8713C>T, NM_004006.2:c.3121C>T, NM_004006.2:c.9164-1G>C, NM_004006.2:c.9164-1G>T, NM_004006.2:c.9337C>T, NM_004006.2:c.6906G>A, NM_004006.2:c.9361+1G>C, NM_004006.2:c.9380C>G, NM_004006.2:c.9564-1G>A, NM_004006.2:c.9568C>T, NM_004006.2:c.9612_9613ins341, NM_004006.2:c.9650-2A>G, NM_004006.2:c.9767dupG, NM_004006.2:c.9851G>A, NM_004006.2:c.9854_9863delTGAGACTGGA, NM_004006.2:c.9862G>T, NM_004006.2:c.3276+1G>A, NM_004006.2:c.2866C>T, NM_004006.2:c.2929dupC, NM_004006.2:c.3022A>T, NM_004006.2:c.2816T>A, NM_004006.2:c.3087G>A, NM_004006.2:c.5899C>T, NM_004006.2:c.3124A>T, NM_004006.2:c.3076G>T, NM_004006.2:c.6373C>T, NM_004006.2:c.627delA, NM_004006.2:c.2137C>T, NM_004006.2:c.3246_3247insTTTCTAAAAA, NM_004006.2:c.220delC, NM_004006.2:c.2169-3_2169-1delinsAA, NM_004006.2:c.6340A>T, NM_004006.2:c.6763-2A>G600
DMDDuchenne muscular dystrophy-insDuchenne, delDuchenne (Detection by MLPA)600
DMP1Hypophosphatemic rickets type 1, autosomal recessiveNM_004407.3NM_004407.3:c.1A>G, NM_004407.3:c.55-1G>C, NM_004407.3:c.31delT, NM_004407.3:c.362delC600
DNAJC19Dilated cardiomyopathy with ataxiaNM_145261.3NM_145261.3:c.300delA600
DPAGT1Congenital disorder of glycosylation type 1jNM_001382.3NM_001382.3:c.791T>G, NM_001382.3:c.358C>A, NM_001382.3:c.643+1G>A, NM_001382.3:c.902G>A, NM_001382.3:c.349G>A, NM_001382.3:c.980_981delCT600
DPM1Congenital disorders of glycosylation type 1eNM_003859.1NM_003859.1:c.564-1G>A, NM_003859.1:c.628delC, NM_003859.1:c.274C>G, NM_003859.1:c.679-1G>T, NM_003859.1:c.742T>C600
DPYDDihydropyrimidine dehydrogenase deficiencyNM_000110.3NM_000110.3:c.775A>G, NM_000110.3:c.1679T>G, NM_000110.3:c.299_302delTCAT, NM_000110.3:c.703C>T, NM_000110.3:c.1109_1110delTA, NM_000110.3:c.1905+1G>A, NM_000110.3:c.257C>T250,600
DSPCardiomyopathy, arrhythmogenicNM_004415.2NM_004415.2:c.7000C>T, NM_004415.2:c.88G>A, NM_004415.2:c.6370_6371delCT, NM_004415.2:c.7180_7181delAG, NM_004415.2:c.643G>A, NM_004415.2:c.3098delA, NM_004415.2:c.8188C>T250,600
DSPCardiomyopathy, dilated, with woolly hair and keratodermaNM_004415.2NM_004415.2:c.5513G>A250,600
DSPLethal acantholytic epidermolysis bullosaNM_004415.2NM_004415.2:c.5800C>T250,600
DYSFDysferlinopathyNM_003494.3NM_003494.3:c.1398-2A>G, NM_003494.3:c.1392dupA, NM_003494.3:c.1398-1G>A, NM_003494.3:c.5266C>T, NM_003494.3:c.1620delA, NM_003494.3:c.1481-1G>A, NM_003494.3:c.3041A>G, NM_003494.3:c.3985C>G, NM_003494.3:c.4090C>T, NM_003494.3:c.5713C>T, NM_003494.3:c.1053+1G>A, NM_003494.3:c.200_201delTGinsAT, NM_003494.3:c.2869C>T, NM_003494.3:c.2870_2874delAGACC, NM_003494.3:c.458-390C>T, NM_003494.3:c.757C>T, NM_003494.3:c.3065G>A, NM_003494.3:c.393_394delCC, NM_003494.3:c.3859A>T, NM_003494.3:c.5429G>A, NM_003494.3:c.3130C>T, NM_003494.3:c.3444_3445delTGinsAA, NM_003494.3:c.1638+2T>A, NM_003494.3:c.4108_4109delGT, NM_003494.3:c.3641delC, NM_003494.3:c.1368C>A, NM_003494.3:c.4872_4876delGCCCGinsCCCC, NM_003494.3:c.5341-2A>C, NM_003494.3:c.509C>A, NM_003494.3:c.5836_5839delCAGC, NM_003494.3:c.5644C>T, NM_003494.3:c.1861G>C, NM_003494.3:c.5429+1G>T, NM_003494.3:c.3957delC, NM_003494.3:c.5998C>T, NM_003494.3:c.3724C>T, NM_003494.3:c.5525+1G>A, NM_003494.3:c.3477C>A, NM_003494.3:c.3708delA, NM_003494.3:c.5992G>T, NM_003494.3:c.3113G>C, NM_003494.3:c.1216T>C, NM_003494.3:c.3903delG250,600
DYSFMiyoshi myopathyNM_003494.3NM_003494.3:c.1555G>A, NM_003494.3:c.5509G>A, NM_003494.3:c.5077C>T, NM_003494.3:c.5698_5699delAG, NM_003494.3:c.3892A>G, NM_003494.3:c.286A>C, NM_003494.3:c.1120G>C, NM_003494.3:c.1284+2T>C, NM_003494.3:c.5497G>T, NM_003494.3:c.3478C>T, NM_003494.3:c.2997G>T, NM_003494.3:c.3121C>T, NM_003494.3:c.1813C>T, NM_003494.3:c.3181_3182insAGGCGG, NM_003494.3:c.937+1G>A, NM_003494.3:c.3158T>G, NM_003494.3:c.1276G>A, NM_003494.3:c.701G>A, NM_003494.3:c.610C>T, NM_003494.3:c.5594delG, NM_003494.3:c.3112C>T, NM_003494.3:c.4199C>A, NM_003494.3:c.5999G>A, NM_003494.3:c.4756C>T, NM_003494.3:c.6124C>T, NM_003494.3:c.2966C>T, NM_003494.3:c.663+1G>C, NM_003494.3:c.3175-2A>T, NM_003494.3:c.895G>T, NM_003494.3:c.4985C>T, NM_003494.3:c.6203C>T250,600
DYSFMuscular dystrophy, limb girdle type 2BNM_003494.3NM_003494.3:c.5979dupA, NM_003494.3:c.565C>G, NM_003494.3:c.1663C>T, NM_003494.3:c.1873G>T, NM_003494.3:c.1834C>T, NM_003494.3:c.5201A>G, NM_003494.3:c.895G>A, NM_003494.3:c.3805G>T, NM_003494.3:c.4003G>A, NM_003494.3:c.4253G>A250,600
EDAHypohidrotic ectodermal dysplasia, X-linkedNM_001399.4NM_001399.4:c.206G>T, NM_001399.4:c.463C>T, NM_001399.4:c.187G>A, NM_001399.4:c.573_574insT, NM_001399.4:c.466C>T, NM_001399.4:c.826C>T, NM_001399.4:c.183C>G, NM_001399.4:c.181T>C, NM_001399.4:c.467G>A, NM_001399.4:c.671G>C, NM_001399.4:c.1045G>A250,600
EDN3Shah-Waardenburg syndrome type 4BNM_207034.1NM_207034.1:c.277C>G, NM_207034.1:c.568_569delGA, NM_207034.1:c.262_263delGCinsT, NM_207034.1:c.559_560insA, NM_207034.1:c.565_566insA, NM_207034.1:c.476G>T600
EDNRBShah-Waardenburg syndrome type 4ANM_000115.3NM_000115.3:c.914C>A, NM_000115.3:c.548C>G, NM_000115.3:c.828G>T, NM_000115.3:c.-51-946delC600
EGR2Charcot-Marie-Tooth disease type 4ENM_000399.3NM_000399.3:c.803T>A600
EIF2AK3Wolcott-Rallison syndromeNM_004836.5NM_004836.5:c.994G>T, NM_004836.5:c.1763G>A600
EMDEmery-Dreifuss muscular dystrophy type 1, X-linkedNM_000117.2NM_000117.2:c.547C>A, NM_000117.2:c.631_635delCGTGC600
ENO3Glycogen storage disease type 13NM_053013.3NM_053013.3:c.667+1G>T, NM_053013.3:c.1121G>A, NM_053013.3:c.953delA, NM_053013.3:c.692_707dupTCCAGGCGGCTGGTTA, NM_053013.3:c.467G>A, NM_053013.3:c.1303T>C250,600
ENPP1Generalized arterial calcification of infancy and pseudoxanthoma elasticumNM_006208.2NM_006208.2:c.1612G>C600
ENPP1Hypophosphatemic rickets type 2, Autosomal recessiveNM_006208.2NM_006208.2:c.797G>T, NM_006208.2:c.2702A>C600
ENPP1Idiopathic infantile arterial calcificationNM_006208.2NM_006208.2:c.1112A>T, NM_006208.2:c.1025G>T, NM_006208.2:c.783C>G, NM_006208.2:c.2677G>T, NM_006208.2:c.913C>A, NM_006208.2:c.2230C>T, NM_006208.2:c.900G>A600
ERCC2TrichothiodystrophyNM_000400.3NM_000400.3:c.1972C>T250,600
ERCC2Xeroderma pigmentosum complementation group DNM_000400.3NM_000400.3:c.1308-1G>A, NM_000400.3:c.1454T>C, NM_000400.3:c.1621A>C, NM_000400.3:c.1703_1704delTT, NM_000400.3:c.1381C>G, NM_000400.3:c.719-1G>A, NM_000400.3:c.2230_2233dupCTAG, NM_000400.3:c.183+2T>A, NM_000400.3:c.567G>A, NM_000400.3:c.1354C>T, NM_000400.3:c.2047C>T, NM_000400.3:c.1304T>G, NM_000400.3:c.2176C>T, NM_000400.3:c.950-2A>G, NM_000400.3:c.949+1G>A250,600
ERCC3Xeroderma pigmentosum complementation group BNM_000122.1NM_000122.1:c.1633C>T, NM_000122.1:c.1757_1758delAG, NM_000122.1:c.296T>C, NM_000122.1:c.1273C>T, NM_000122.1:c.1757delA, NM_000122.1:c.1858delG600
ERCC4Xeroderma pigmentosum complementation group FNM_005236.2NM_005236.2:c.49G>T, NM_005236.2:c.1467_1468insA, NM_005236.2:c.2281_2284delTTTG, NM_005236.2:c.2T>C, NM_005236.2:c.538_539delAG, NM_005236.2:c.706T>C, NM_005236.2:c.2395C>T250,600
ERCC5Xeroderma pigmentosum complementation group GNM_000123.3NM_000123.3:c.2620G>A, NM_000123.3:c.463_464insA, NM_000123.3:c.526C>T, NM_000123.3:c.88+2T>C, NM_000123.3:c.2144dupA, NM_000123.3:c.2375C>T, NM_000123.3:c.381-2A>G, NM_000123.3:c.2573T>C, NM_000123.3:c.406C>T, NM_000123.3:c.215C>A, NM_000123.3:c.787C>T, NM_000123.3:c.2751delA250,600
ERCC6Cerebrooculofacioskeletal syndrome tipo 1NM_000124.3NM_000124.3:c.2047C>T250,600
ERCC6Cockayne syndrome type BNM_000124.3NM_000124.3:c.207_208insG, NM_000124.3:c.2203C>T, NM_000124.3:c.1357C>T, NM_000124.3:c.48_49delCT, NM_000124.3:c.3592_3593insGA, NM_000124.3:c.422+1G>A, NM_000124.3:c.1550G>A, NM_000124.3:c.3284C>G, NM_000124.3:c.2587C>T, NM_000124.3:c.3862C>T250,600
ERCC8Cockayne syndrome type ANM_000082.3NM_000082.3:c.1103_1108delAGTTinsTTATATGAACCTTATATGAA, NM_000082.3:c.618-1G>A, NM_000082.3:c.593_594dupAT, NM_000082.3:c.613G>C, NM_000082.3:c.966C>A, NM_000082.3:c.37G>T600
ESCO2Roberts syndromeNM_001017420.2NM_001017420.2:c.1615T>G, NM_001017420.2:c.879_880delAG, NM_001017420.2:c.1597dupT, NM_001017420.2:c.505C>T, NM_001017420.2:c.291_292insGA, NM_001017420.2:c.308_309delAA, NM_001017420.2:c.876_879delCAGA, NM_001017420.2:c.874_877delGACA600
ESCO2SC Phocomelia syndromeNM_001017420.2NM_001017420.2:c.1269G>A, NM_001017420.2:c.604C>T600
ESPNDeafness type 36, autosomal recessiveNM_031475.2NM_031475.2:c.1988_1991delAGAG, NM_031475.2:c.2230G>A, NM_031475.2:c.2470_2473delTCAG600
ESRRBDeafness type 35, autosomal recessiveNM_004452.3NM_004452.3:c.329C>T600
ETFAGlutaric acidemia type 2ANM_000126.3NM_000126.3:c.470T>G, NM_000126.3:c.797C>T600
ETFBGlutaric acidemia type 2BNM_001985.2NM_001985.2:c.278_279insG, NM_001985.2:c.490C>T, NM_001985.2:c.491G>A, NM_001985.2:c.382G>A, NM_001985.2:c.58-53_58-52insG, NM_001985.2:c.61C>T, NM_001985.2:c.614_616delAGA600
ETFDHGlutaric acidemia type 2CNM_004453.3NM_004453.3:c.1823delG, NM_004453.3:c.1570_1571delCT, NM_004453.3:c.2T>C, NM_004453.3:c.1234G>T, NM_004453.3:c.250G>A, NM_004453.3:c.1351G>C, NM_004453.3:c.1367C>T, NM_004453.3:c.524G>T, NM_004453.3:c.1001T>C, NM_004453.3:c.1773_1774delAT, NM_004453.3:c.1832G>A, NM_004453.3:c.508G>T, NM_004453.3:c.413T>G, NM_004453.3:c.643G>A600
ETHE1Ethylmalonic encephalopathyNM_014297.3NM_014297.3:c.487C>T, NM_014297.3:c.554T>G, NM_014297.3:c.440_450delACAGCATGGCC, NM_014297.3:c.604dupG, NM_014297.3:c.221dupA, NM_014297.3:c.488G>A600
EYSRetinitis pigmentosa type 25NM_001142800.1NM_001142800.1:c.5044G>T, NM_001142800.1:c.9036delT, NM_001142800.1:c.490C>T, NM_001142800.1:c.5928-2A>G, NM_001142800.1:c.571dupA, NM_001142800.1:c.4597_4613delTCAAGCAACCAGAGACT, NM_001142800.1:c.7822C>T, NM_001142800.1:c.5857G>T, NM_001142800.1:c.6170delA, NM_001142800.1:c.8569G>T, NM_001142800.1:c.232delT, NM_001142800.1:c.6102_6103insT, NM_001142800.1:c.8834G>A, NM_001142800.1:c.1211_1212insA, NM_001142800.1:c.4350_4356delTATAGCT, NM_001142800.1:c.4469_4470insAGCCCCTC, NM_001142800.1:c.8648_8655delCATGCAGA, NM_001142800.1:c.4120C>T, NM_001142800.1:c.863-4_863-3insT, NM_001142800.1:c.8629_8632dupACAG, NM_001142800.1:c.9299_9302delCTCA, NM_001142800.1:c.103C>T, NM_001142800.1:c.2826_2827delAT, NM_001142800.1:c.4045C>T, NM_001142800.1:c.5757_5758insT, NM_001142800.1:c.8408dupA, NM_001142800.1:c.7095T>G, NM_001142800.1:c.3329C>G, NM_001142800.1:c.9405T>A250,600
F11Factor 11 deficiencyNM_000128.3NM_000128.3:c.1613C>T, NM_000128.3:c.166T>C, NM_000128.3:c.403G>T, NM_000128.3:c.731A>G, NM_000128.3:c.809A>T, NM_000128.3:c.1693G>A, NM_000128.3:c.1211C>A, NM_000128.3:c.901T>C, NM_000128.3:c.595+3A>G, NM_000128.3:c.438C>A250,600
F5Factor 5 deficiencyNM_000130.4NM_000130.4:c.4876delA, NM_000130.4:c.439G>T, NM_000130.4:c.6419G>A, NM_000130.4:c.2401C>T, NM_000130.4:c.5521G>A, NM_000130.4:c.1083G>A, NM_000130.4:c.5189A>G, NM_000130.4:c.3799delC, NM_000130.4:c.6304C>T250,600
F5ThrombosisNM_000130.4NM_000130.4:c.1000A>G250,600
F8Hemophilia ANM_000132.3NM_000132.3:c.1075_1078delAATG, NM_000132.3:c.1042T>C, NM_000132.3:c.1078_1079delGA, NM_000132.3:c.120delC, NM_000132.3:c.1214T>G, NM_000132.3:c.1090G>A, NM_000132.3:c.1207C>G, NM_000132.3:c.1331_1332delAAinsT, NM_000132.3:c.1175C>A, NM_000132.3:c.1335dupC, NM_000132.3:c.1203G>A, NM_000132.3:c.128dupT, NM_000132.3:c.1331A>C, NM_000132.3:c.1301G>A, NM_000132.3:c.1234T>C, NM_000132.3:c.1316G>A, NM_000132.3:c.1293delG, NM_000132.3:c.1200_1201delTT, NM_000132.3:c.1310delG, NM_000132.3:c.1331_1332delAA, NM_000132.3:c.1410_1413delTTTA, NM_000132.3:c.1420G>T, NM_000132.3:c.143+1G>A, NM_000132.3:c.1432G>A, NM_000132.3:c.1438_1439delCT, NM_000132.3:c.1440_1441insA, NM_000132.3:c.144-11T>G, NM_000132.3:c.1442_1443dupTG, NM_000132.3:c.1175C>G, NM_000132.3:c.1324T>A, NM_000132.3:c.1324T>C, NM_000132.3:c.1325A>G, NM_000132.3:c.144-5C>G, NM_000132.3:c.1463C>G, NM_000132.3:c.1463C>T, NM_000132.3:c.1467_1472dupCAGACC, NM_000132.3:c.1477A>G, NM_000132.3:c.1538-1G>T, NM_000132.3:c.1538-2A>T, NM_000132.3:c.1560delT, NM_000132.3:c.1564_1565delATinsTA, NM_000132.3:c.1585A>G, NM_000132.3:c.1594T>G, NM_000132.3:c.1189_1190insC, NM_000132.3:c.1443+3A>C, NM_000132.3:c.1596G>A, NM_000132.3:c.1618C>A, NM_000132.3:c.1619C>G, NM_000132.3:c.1630G>A, NM_000132.3:c.1639T>C, NM_000132.3:c.1337G>A, NM_000132.3:c.1337G>C, NM_000132.3:c.1338delA, NM_000132.3:c.1348T>G, NM_000132.3:c.1357G>T, NM_000132.3:c.1390G>T, NM_000132.3:c.1595G>A, NM_000132.3:c.1596dupG, NM_000132.3:c.1400T>G, NM_000132.3:c.1406G>C, NM_000132.3:c.1736A>T, NM_000132.3:c.173delC, NM_000132.3:c.1752+5G>C, NM_000132.3:c.185C>G, NM_000132.3:c.1904-1G>A, NM_000132.3:c.1904-37G>A, NM_000132.3:c.1912G>A, NM_000132.3:c.1913G>A, NM_000132.3:c.1924_1927delGATA, NM_000132.3:c.1934A>C, NM_000132.3:c.1941_1944delAGTT, NM_000132.3:c.1943_1946delTTTG, NM_000132.3:c.1952A>C, NM_000132.3:c.195C>A, NM_000132.3:c.1985G>C, NM_000132.3:c.1988C>T, NM_000132.3:c.1990_1991delCA, NM_000132.3:c.1991A>C, NM_000132.3:c.199_200delAA, NM_000132.3:c.1992_1995dupGACT, NM_000132.3:c.1996_1999delGACT, NM_000132.3:c.1999delT, NM_000132.3:c.199A>G, NM_000132.3:c.1A>G, NM_000132.3:c.2009_2011delTCT, NM_000132.3:c.200A>C, NM_000132.3:c.201G>T, NM_000132.3:c.202_203insGA, NM_000132.3:c.202_207delACTCTG, NM_000132.3:c.2029T>C, NM_000132.3:c.2032A>T, NM_000132.3:c.203C>A, NM_000132.3:c.2057C>G, NM_000132.3:c.2058_2059delAC, NM_000132.3:c.2060T>C, NM_000132.3:c.2066T>G, NM_000132.3:c.1394C>G, NM_000132.3:c.1397G>A, NM_000132.3:c.2077_2078delTCinsCT, NM_000132.3:c.2088_2089delTG, NM_000132.3:c.2090T>A, NM_000132.3:c.2095A>C, NM_000132.3:c.2095A>G, NM_000132.3:c.2095A>T, NM_000132.3:c.1086G>A, NM_000132.3:c.2097G>A, NM_000132.3:c.1164delC, NM_000132.3:c.1172G>C, NM_000132.3:c.214G>A, NM_000132.3:c.217T>C, NM_000132.3:c.1187A>T, NM_000132.3:c.224delA, NM_000132.3:c.225T>A, NM_000132.3:c.1202G>A, NM_000132.3:c.2338delA, NM_000132.3:c.2360delA, NM_000132.3:c.2372dupG, NM_000132.3:c.2374delT, NM_000132.3:c.2383A>G, NM_000132.3:c.2384_2388delGAACA, NM_000132.3:c.2397delT, NM_000132.3:c.2404C>T, NM_000132.3:c.2409delT, NM_000132.3:c.2412_2421delCTCCTCTAGT, NM_000132.3:c.2419dupA, NM_000132.3:c.2462_2463delGG, NM_000132.3:c.250_255delAGGCCA, NM_000132.3:c.250A>G, NM_000132.3:c.253_255delCCA, NM_000132.3:c.265+1G>T, NM_000132.3:c.265G>A, NM_000132.3:c.3031A>T, NM_000132.3:c.3034G>C, NM_000132.3:c.3053delA, NM_000132.3:c.3150_3151insTC, NM_000132.3:c.3152delT, NM_000132.3:c.3168_3187delTGAGTTTAAAAAAGTGACAC, NM_000132.3:c.3196C>T, NM_000132.3:c.3202_3203delAG, NM_000132.3:c.3224delC, NM_000132.3:c.3251C>G, NM_000132.3:c.3255_3258delTAAA, NM_000132.3:c.3279G>A, NM_000132.3:c.3289C>T, NM_000132.3:c.3295delA, NM_000132.3:c.3298A>T, NM_000132.3:c.3302_3303delAG, NM_000132.3:c.3344delT, NM_000132.3:c.3371C>A, NM_000132.3:c.144-26A>T, NM_000132.3:c.1443+1G>A, NM_000132.3:c.1443+2T>C, NM_000132.3:c.3409_3410delCT, NM_000132.3:c.3416_3417delCT, NM_000132.3:c.3417dupT, NM_000132.3:c.3421C>T, NM_000132.3:c.3490delT, NM_000132.3:c.3493G>T, NM_000132.3:c.3496A>T, NM_000132.3:c.3500dupA, NM_000132.3:c.3505delG, NM_000132.3:c.3540delA, NM_000132.3:c.3548_3549delAA, NM_000132.3:c.3565dupA, NM_000132.3:c.3607G>T, NM_000132.3:c.3624delT, NM_000132.3:c.3631A>T, NM_000132.3:c.3651delA, NM_000132.3:c.3652delG, NM_000132.3:c.3710delC, NM_000132.3:c.3721_3739del19ins6, NM_000132.3:c.3735_3744delCCTTTTCTTAinsATTTCTTTTTCTTT, NM_000132.3:c.3736delC, NM_000132.3:c.3756delG, NM_000132.3:c.3766G>T, NM_000132.3:c.3771delT, NM_000132.3:c.3827C>G, NM_000132.3:c.3830delC, NM_000132.3:c.3833delA, NM_000132.3:c.3842_3844delAGAinsGG, NM_000132.3:c.3844A>T, NM_000132.3:c.3847_3848delCA, NM_000132.3:c.3858delT, NM_000132.3:c.3860delT, NM_000132.3:c.3863dupC, NM_000132.3:c.3870dupA, NM_000132.3:c.3886delT, NM_000132.3:c.3902delA, NM_000132.3:c.3907_3911delACCAA, NM_000132.3:c.3913C>T, NM_000132.3:c.3922G>T, NM_000132.3:c.3940A>C, NM_000132.3:c.3964C>T, NM_000132.3:c.3967C>T, NM_000132.3:c.3982C>T, NM_000132.3:c.3984dupA, NM_000132.3:c.3991_3992delAA, NM_000132.3:c.3994_3997delAGAG, NM_000132.3:c.4006C>T, NM_000132.3:c.4034delA, NM_000132.3:c.403G>A, NM_000132.3:c.4045delA, NM_000132.3:c.404A>G, NM_000132.3:c.405T>A, NM_000132.3:c.4072C>T, NM_000132.3:c.407A>C, NM_000132.3:c.4093_4099delCATTTGA, NM_000132.3:c.4100delC, NM_000132.3:c.4113_4153dup41, NM_000132.3:c.4156C>T, NM_000132.3:c.415C>T, NM_000132.3:c.4197delC, NM_000132.3:c.4201C>T, NM_000132.3:c.421G>T, NM_000132.3:c.4241C>A, NM_000132.3:c.4242dupA, NM_000132.3:c.4264_4265delTA, NM_000132.3:c.2071C>A, NM_000132.3:c.2072C>T, NM_000132.3:c.4293_4297delCTCTT, NM_000132.3:c.4296_4300delTTCTC, NM_000132.3:c.430G>T, NM_000132.3:c.4318delT, NM_000132.3:c.4336delG, NM_000132.3:c.4339dupG, NM_000132.3:c.2096T>A, NM_000132.3:c.4345delG, NM_000132.3:c.209T>C, NM_000132.3:c.2101_2105delATGGA, NM_000132.3:c.4363C>T, NM_000132.3:c.4382_4383delAC, NM_000132.3:c.223G>T, NM_000132.3:c.4408G>T, NM_000132.3:c.440T>A, NM_000132.3:c.230T>C, NM_000132.3:c.4424_4425delAA, NM_000132.3:c.4426_4427delAG, NM_000132.3:c.4429_4430delGA, NM_000132.3:c.4446dupG, NM_000132.3:c.4450delA, NM_000132.3:c.4458delA, NM_000132.3:c.446delC, NM_000132.3:c.4473C>A, NM_000132.3:c.4473C>G, NM_000132.3:c.4474A>T, NM_000132.3:c.4483delG, NM_000132.3:c.4483G>T, NM_000132.3:c.4491_4492delTG, NM_000132.3:c.4491_4495delTGTTC, NM_000132.3:c.4492_4496delGTTCT, NM_000132.3:c.4492delG, NM_000132.3:c.4512_4513ins32, NM_000132.3:c.4512delG, NM_000132.3:c.4513_4515delCCCinsGCAAAGTTGGTTTGCCAAAACCATGTTGCCG, NM_000132.3:c.4519delA, NM_000132.3:c.4531G>A, NM_000132.3:c.4542delT, NM_000132.3:c.4543_4544delCCinsA, NM_000132.3:c.4549_4550delGT, NM_000132.3:c.4561C>T, NM_000132.3:c.4619delT, NM_000132.3:c.4658delA, NM_000132.3:c.4662_4663delGA, NM_000132.3:c.4665_4688del24insAAGGAA, NM_000132.3:c.4672_4675delAACA, NM_000132.3:c.4683delA, NM_000132.3:c.4687delG, NM_000132.3:c.4694_4697delTTCT, NM_000132.3:c.4697_4701dupTGAGA, NM_000132.3:c.4710_4713delAGAA, NM_000132.3:c.3385delC, NM_000132.3:c.3388delA, NM_000132.3:c.3402delG, NM_000132.3:c.472C>T, NM_000132.3:c.476T>C, NM_000132.3:c.4770T>A, NM_000132.3:c.4794G>T, NM_000132.3:c.4798A>T, NM_000132.3:c.4805_4806delAA, NM_000132.3:c.4805delA, NM_000132.3:c.4814C>A, NM_000132.3:c.4825delA, NM_000132.3:c.4828G>T, NM_000132.3:c.4841delA, NM_000132.3:c.4848delC, NM_000132.3:c.4856delC, NM_000132.3:c.4858delC, NM_000132.3:c.4864G>A, NM_000132.3:c.4895delT, NM_000132.3:c.4895dupT, NM_000132.3:c.4899delT, NM_000132.3:c.489T>A, NM_000132.3:c.4918G>T, NM_000132.3:c.4922dupT, NM_000132.3:c.4925A>G, NM_000132.3:c.4926delA, NM_000132.3:c.4934G>A, NM_000132.3:c.4935G>A, NM_000132.3:c.493C>T, NM_000132.3:c.4942C>T, NM_000132.3:c.4969C>T, NM_000132.3:c.4979C>T, NM_000132.3:c.4987A>T, NM_000132.3:c.4996C>T, NM_000132.3:c.4999delC, NM_000132.3:c.5010delT, NM_000132.3:c.5012G>A, NM_000132.3:c.514_515insTCAAGATA, NM_000132.3:c.514T>C, NM_000132.3:c.515G>A, NM_000132.3:c.519_523delTACCT, NM_000132.3:c.5220-1G>A, NM_000132.3:c.5226_5227delGA, NM_000132.3:c.5243delA, NM_000132.3:c.5251A>T, NM_000132.3:c.5254delG, NM_000132.3:c.525C>A, NM_000132.3:c.5269delT, NM_000132.3:c.5269T>C, NM_000132.3:c.5291A>G, NM_000132.3:c.5301C>A, NM_000132.3:c.5308G>A, NM_000132.3:c.5321A>T, NM_000132.3:c.532C>G, NM_000132.3:c.5330T>C, NM_000132.3:c.5337delG, NM_000132.3:c.5339C>T, NM_000132.3:c.5343T>A, NM_000132.3:c.5345T>G, NM_000132.3:c.5348_5357delGAGCAGAAGT, NM_000132.3:c.535T>C, NM_000132.3:c.545A>T, NM_000132.3:c.553A>G, NM_000132.3:c.556G>A, NM_000132.3:c.557_559delACT, NM_000132.3:c.557A>G, NM_000132.3:c.560T>A, NM_000132.3:c.566C>A, NM_000132.3:c.5674G>A, NM_000132.3:c.5675dupT, NM_000132.3:c.5680G>A, NM_000132.3:c.5686G>C, NM_000132.3:c.5689_5690delCT, NM_000132.3:c.5696dupT, NM_000132.3:c.5697delC, NM_000132.3:c.5712G>C, NM_000132.3:c.5718dupA, NM_000132.3:c.5719A>T, NM_000132.3:c.571C>T, NM_000132.3:c.5721C>G, NM_000132.3:c.5722_5723delTGinsTCATCAAAGTACTTCAAAAA, NM_000132.3:c.5752delT, NM_000132.3:c.5766C>A, NM_000132.3:c.577G>A, NM_000132.3:c.5816-14delGTinsTA, NM_000132.3:c.5816C>A, NM_000132.3:c.5816C>T, NM_000132.3:c.5825G>T, NM_000132.3:c.5833A>G, NM_000132.3:c.5853A>C, NM_000132.3:c.5861_5866delCTCAGG, NM_000132.3:c.5869C>T, NM_000132.3:c.5879G>T, NM_000132.3:c.5881T>A, NM_000132.3:c.5884T>G, NM_000132.3:c.5888T>C, NM_000132.3:c.5891T>C, NM_000132.3:c.5894G>T, NM_000132.3:c.589_591delGTA, NM_000132.3:c.5914_5915delAT, NM_000132.3:c.5923dupA, NM_000132.3:c.5924T>A, NM_000132.3:c.5934T>G, NM_000132.3:c.5939A>C, NM_000132.3:c.5953delC, NM_000132.3:c.5954G>C, NM_000132.3:c.5955_5956delAA, NM_000132.3:c.5955delA, NM_000132.3:c.5964_5967dupGGAG, NM_000132.3:c.5999G>C, NM_000132.3:c.6016G>T, NM_000132.3:c.6037G>A, NM_000132.3:c.6046C>G, NM_000132.3:c.6070dupC, NM_000132.3:c.6078_6079delTG, NM_000132.3:c.6082delG, NM_000132.3:c.6089dupG, NM_000132.3:c.6094C>T, NM_000132.3:c.6099delT, NM_000132.3:c.6107A>G, NM_000132.3:c.6115+1G>A, NM_000132.3:c.6115+2T>C, NM_000132.3:c.6115+3G>T, NM_000132.3:c.6115+4A>G, NM_000132.3:c.6115+6T>A, NM_000132.3:c.6116-2A>G, NM_000132.3:c.6116_6117delAG, NM_000132.3:c.6120_6135delTCAGACTCCCCTGGGA, NM_000132.3:c.6120T>A, NM_000132.3:c.6127delC, NM_000132.3:c.6134G>T, NM_000132.3:c.6135dupA, NM_000132.3:c.6194G>A, NM_000132.3:c.6202_6257dup56, NM_000132.3:c.6213A>T, NM_000132.3:c.6239C>T, NM_000132.3:c.6242G>C, NM_000132.3:c.6243G>C, NM_000132.3:c.6250A>T, NM_000132.3:c.6253G>T, NM_000132.3:c.6263C>T, NM_000132.3:c.6269T>A, NM_000132.3:c.6273+1G>A, NM_000132.3:c.6430-3C>G, NM_000132.3:c.6449A>T, NM_000132.3:c.6464_6465delAA, NM_000132.3:c.6465delA, NM_000132.3:c.6467_6468delAC, NM_000132.3:c.6469_6470delAA, NM_000132.3:c.6473delT, NM_000132.3:c.6482C>A, NM_000132.3:c.6482C>T, NM_000132.3:c.6488T>G, NM_000132.3:c.6489delT, NM_000132.3:c.6494delC, NM_000132.3:c.6497delG, NM_000132.3:c.6501delC, NM_000132.3:c.6515C>G, NM_000132.3:c.6517_6519dupACT, NM_000132.3:c.6520C>G, NM_000132.3:c.6533G>A, NM_000132.3:c.6537C>G, NM_000132.3:c.6544C>G, NM_000132.3:c.6548T>G, NM_000132.3:c.6551A>T, NM_000132.3:c.6565_6566delGA, NM_000132.3:c.6574+1G>A, NM_000132.3:c.6574+1G>T, NM_000132.3:c.6574+3A>C, NM_000132.3:c.6574+5G>C, NM_000132.3:c.65G>C, NM_000132.3:c.6738delA, NM_000132.3:c.6739_6740delGA, NM_000132.3:c.6739G>T, NM_000132.3:c.6743G>C, NM_000132.3:c.6746T>G, NM_000132.3:c.6752T>A, NM_000132.3:c.6760C>T, NM_000132.3:c.6760delC, NM_000132.3:c.676A>T, NM_000132.3:c.6780_6788delAGGAGTAAC, NM_000132.3:c.6786_6787insCAA, NM_000132.3:c.6796G>A, NM_000132.3:c.6797delG, NM_000132.3:c.6797G>A, NM_000132.3:c.6804delA, NM_000132.3:c.680G>A, NM_000132.3:c.6825T>A, NM_000132.3:c.6827T>G, NM_000132.3:c.6836T>C, NM_000132.3:c.6836T>G, NM_000132.3:c.6839T>C, NM_000132.3:c.6842T>C, NM_000132.3:c.684_685delCT, NM_000132.3:c.6856_6866delGATGGCCATCA, NM_000132.3:c.6865C>T, NM_000132.3:c.6869G>T, NM_000132.3:c.6870G>A, NM_000132.3:c.687_688delAG, NM_000132.3:c.6886delA, NM_000132.3:c.6900+1G>A, NM_000132.3:c.6901-2A>G, NM_000132.3:c.6904T>G, NM_000132.3:c.6905T>C, NM_000132.3:c.6912_6916delAAATC, NM_000132.3:c.6915delT, NM_000132.3:c.6919_6920delGA, NM_000132.3:c.6921delC, NM_000132.3:c.693_696delAAAG, NM_000132.3:c.6969_6977delCTACCTTCG, NM_000132.3:c.6976C>G, NM_000132.3:c.6986C>T, NM_000132.3:c.6988delC, NM_000132.3:c.6995G>C, NM_000132.3:c.6996G>A, NM_000132.3:c.6997delG, NM_000132.3:c.7012delC, NM_000132.3:c.7016G>T, NM_000132.3:c.7021G>T, NM_000132.3:c.7030G>A, NM_000132.3:c.7030G>T, NM_000132.3:c.7031G>A, NM_000132.3:c.7033_7040delTGCGAGGC, NM_000132.3:c.7034G>A, NM_000132.3:c.709C>T, NM_000132.3:c.729delT, NM_000132.3:c.73delT, NM_000132.3:c.755C>A, NM_000132.3:c.760A>T, NM_000132.3:c.764G>A, NM_000132.3:c.770_771insCC, NM_000132.3:c.775A>T, NM_000132.3:c.779C>G, NM_000132.3:c.77T>C, NM_000132.3:c.787+2T>C, NM_000132.3:c.787G>C, NM_000132.3:c.788-1G>A, NM_000132.3:c.788-1G>C, NM_000132.3:c.788-1G>T, NM_000132.3:c.788-2A>T, NM_000132.3:c.796G>T, NM_000132.3:c.820T>C, NM_000132.3:c.822G>A, NM_000132.3:c.824A>G, NM_000132.3:c.832G>A, NM_000132.3:c.836T>A, NM_000132.3:c.849delT, NM_000132.3:c.850G>A, NM_000132.3:c.850G>T, NM_000132.3:c.86T>G, NM_000132.3:c.871G>T, NM_000132.3:c.872A>G, NM_000132.3:c.883T>C, NM_000132.3:c.886C>T, NM_000132.3:c.889delG, NM_000132.3:c.88G>A, NM_000132.3:c.899A>C, NM_000132.3:c.899A>T, NM_000132.3:c.902G>C, NM_000132.3:c.906delG, NM_000132.3:c.912C>T, NM_000132.3:c.918delA, NM_000132.3:c.920T>G, NM_000132.3:c.935delT, NM_000132.3:c.941C>T, NM_000132.3:c.943delG, NM_000132.3:c.948_951delAACA, NM_000132.3:c.967G>A, NM_000132.3:c.974_975delTT, NM_000132.3:c.97T>G, NM_000132.3:c.984delT, NM_000132.3:c.985dupT, NM_000132.3:c.986G>A, NM_000132.3:c.986G>C, NM_000132.3:c.986G>T, NM_000132.3:c.98G>A, NM_000132.3:c.1726G>T, NM_000132.3:c.4345G>T, NM_000132.3:c.435_436insTTT, NM_000132.3:c.433G>C, NM_000132.3:c.4719_4729delTGCAAAGACTC, NM_000132.3:c.439_447dupGTCTTCCCT, NM_000132.3:c.4720delG, NM_000132.3:c.1661G>A, NM_000132.3:c.4423C>T, NM_000132.3:c.1703G>T, NM_000132.3:c.1640G>A, NM_000132.3:c.1682A>C, NM_000132.3:c.1681G>A, NM_000132.3:c.1667T>A, NM_000132.3:c.4272delC, NM_000132.3:c.1653T>G, NM_000132.3:c.471G>A, NM_000132.3:c.1688C>G, NM_000132.3:c.4280delT, NM_000132.3:c.1675G>T600
F8Hemophilia A-Inv22 (Detection by PCR)600
F9Hemophilia BNM_000133.3NM_000133.3:c.1150C>T, NM_000133.3:c.52T>C, NM_000133.3:c.1031T>C, NM_000133.3:c.82T>C, NM_000133.3:c.1136G>A, NM_000133.3:c.79G>A, NM_000133.3:c.19A>T, NM_000133.3:c.80A>T250,600
FAHTyrosinemia type 1NM_000137.2NM_000137.2:c.1141A>G, NM_000137.2:c.1069G>T, NM_000137.2:c.1090G>T, NM_000137.2:c.401C>A, NM_000137.2:c.456G>A, NM_000137.2:c.192G>T, NM_000137.2:c.607-6T>G, NM_000137.2:c.707-1G>A, NM_000137.2:c.939delC, NM_000137.2:c.103G>A, NM_000137.2:c.982C>T, NM_000137.2:c.837+1G>A, NM_000137.2:c.1009G>A, NM_000137.2:c.47A>T, NM_000137.2:c.554-1G>T, NM_000137.2:c.1027G>T, NM_000137.2:c.1062+5G>A, NM_000137.2:c.786G>A, NM_000137.2:c.1021C>T, NM_000137.2:c.782C>T250,600
FAM126AHypomyelination and congenital cataractNM_032581.3NM_032581.3:c.191A>G, NM_032581.3:c.158T>C600
FAM20COsteosclerotic bone dysplasiaNM_020223.3NM_020223.3:c.1093G>C, NM_020223.3:c.773T>A, NM_020223.3:c.1364-5C>T, NM_020223.3:c.1163T>G, NM_020223.3:c.838G>A, NM_020223.3:c.1351G>A600
FANCAFanconi anemia, complementation group ANM_000135.2NM_000135.2:c.3788_3790delTCT, NM_000135.2:c.2303T>C, NM_000135.2:c.3558_3559insG, NM_000135.2:c.4130C>G, NM_000135.2:c.233_236delTTGA, NM_000135.2:c.3763G>T, NM_000135.2:c.1115_1118delTTGG, NM_000135.2:c.131_132insA250,600
FANCCFanconi anemia, complementation group CNM_000136.2NM_000136.2:c.1642C>T, NM_000136.2:c.37C>T, NM_000136.2:c.996+1G>T, NM_000136.2:c.67delG, NM_000136.2:c.416G>A, NM_000136.2:c.1015delA, NM_000136.2:c.1487T>G, NM_000136.2:c.1103_1104delTG250,600
FANCD2Fanconi anemia, complementation group D2NM_033084.3NM_033084.3:c.1278+1delG, NM_033084.3:c.2152C>T, NM_033084.3:c.2494+2T>C, NM_033084.3:c.958C>T, NM_033084.3:c.2444G>A, NM_033084.3:c.782A>T, NM_033084.3:c.904C>T250,600
FANCEFanconi anemia, complementation group ENM_021922.2NM_021922.2:c.1501C>T, NM_021922.2:c.929_930insC, NM_021922.2:c.421C>T, NM_021922.2:c.1114-8G>A, NM_021922.2:c.922_923insC, NM_021922.2:c.355C>T600
FANCGFanconi anemia, complementation group GNM_004629.1NM_004629.1:c.1795_1804delTGGATCCGTC, NM_004629.1:c.313G>T, NM_004629.1:c.637_643delTACCGCC, NM_004629.1:c.1480+1G>C, NM_004629.1:c.1852_1853delAA, NM_004629.1:c.510+1G>A, NM_004629.1:c.1077-2A>G, NM_004629.1:c.908_909insCT250,600
FANCIFanconi anemia, complementation group INM_001113378.1NM_001113378.1:c.3816+1G>A, NM_001113378.1:c.52C>T, NM_001113378.1:c.989_991delTAA, NM_001113378.1:c.2097C>G, NM_001113378.1:c.3466G>C, NM_001113378.1:c.2292-1G>A, NM_001113378.1:c.3492delG, NM_001113378.1:c.3853C>T, NM_001113378.1:c.3626_3627delGT, NM_001113378.1:c.3854G>A250,600
FANCLFanconi anemia, complementation group LNM_018062.3NM_018062.3:c.1051_1052delAG, NM_018062.3:c.1066_1067delAG, NM_018062.3:c.1096_1099dupATTA, NM_018062.3:c.1099_1100insATTA250,600
FANCMFanconi anemia, complementation group MNM_020937.2NM_020937.2:c.2171C>A, NM_020937.2:c.5766_5769delGACT, NM_020937.2:c.5101C>T, NM_020937.2:c.1072G>T, NM_020937.2:c.2996_2997insC, NM_020937.2:c.2586_2589delAAAA, NM_020937.2:c.5791C>T, NM_020937.2:c.624_625delAA, NM_020937.2:c.5569G>A, NM_020937.2:c.5764_5767delCTGA250,600
FGACongenital fibrinogen deficiency (gene FGA)NM_021871.2NM_021871.2:c.1039C>T, NM_021871.2:c.1441delG, NM_021871.2:c.*675_*676insC, NM_021871.2:c.1359dupC, NM_021871.2:c.*1086delG, NM_021871.2:c.1906_1907insC600
FGBCongenital afibrinogenemiaNM_005141.4NM_005141.4:c.1289G>A, NM_005141.4:c.1148T>G, NM_005141.4:c.794C>T250,600
FGD4Charcot-Marie-Tooth disease type 4HNM_139241.2NM_139241.2:c.1325G>A, NM_139241.2:c.893T>G, NM_139241.2:c.893T>C, NM_139241.2:c.670C>T600
FHFumaric aciduriaNM_000143.3NM_000143.3:c.1067T>A, NM_000143.3:c.697C>T, NM_000143.3:c.698G>A, NM_000143.3:c.1236+1G>C, NM_000143.3:c.901dupA, NM_000143.3:c.320A>C, NM_000143.3:c.760C>T, NM_000143.3:c.1431_1433dupAAA, NM_000143.3:c.521C>G, NM_000143.3:c.1093A>G, NM_000143.3:c.1189G>A, NM_000143.3:c.1200delT, NM_000143.3:c.1394A>G, NM_000143.3:c.1255T>C, NM_000143.3:c.793G>A, NM_000143.3:c.40_41insC, NM_000143.3:c.1446_1449delAAAG, NM_000143.3:c.1293delA600
FHL1Emery-Dreifuss muscular dystrophy type 6NM_001449.4NM_001449.4:c.625T>C600
FHL1Myopathy, reducing bodyNM_001449.4NM_001449.4:c.689-479G>A, NM_001449.4:c.310T>C600
FIG4Charcot-Marie-Tooth disease type 4JNM_014845.5NM_014845.5:c.592C>T, NM_014845.5:c.831_838delTAAATTTG, NM_014845.5:c.547C>T, NM_014845.5:c.501C>G, NM_014845.5:c.737G>A, NM_014845.5:c.122T>C, NM_014845.5:c.2296_2297insG250,600
FIG4Yunis-Varon syndromeNM_014845.5NM_014845.5:c.311G>A250,600
FKRPCongenital muscular dystrophy type 5BNM_024301.4NM_024301.4:c.235G>A, NM_024301.4:c.1343C>T, NM_024301.4:c.1387A>G, NM_024301.4:c.1154C>A250,600
FKRPLimb-girdle muscular dystrophy type 2I, autosomal recessiveNM_024301.4NM_024301.4:c.160C>T250,600
FKTNFukuyama congenital muscular dystrophyNM_001079802.1NM_001079802.1:c.1112A>G, NM_001079802.1:c.509C>A, NM_001079802.1:c.411C>A, NM_001079802.1:c.1167dupA600
FKTNMuscular dystrophy, limb girdle, type 2MNM_001079802.1NM_001079802.1:c.1380dupA, NM_001079802.1:c.766C>T, NM_001079802.1:c.527T>C, NM_001079802.1:c.340G>A600
FLNAFrontometaphyseal dysplasiaNM_001456.3NM_001456.3:c.4447_4448insAT, NM_001456.3:c.760G>A, NM_001456.3:c.3476A>C, NM_001456.3:c.3557C>T600
FLNAPeriventricular heterotopiaNM_001456.3NM_001456.3:c.4543C>T, NM_001456.3:c.7129C>T, NM_001456.3:c.7733-1G>C, NM_001456.3:c.7527_7528+6delAGGTGAGC, NM_001456.3:c.5108_5109delTCinsAA, NM_001456.3:c.2761C>T, NM_001456.3:c.4777_4778dupAA600
FLVCR1Ataxia, posterior column, with retinitis pigmentosaNM_014053.3NM_014053.3:c.361A>G, NM_014053.3:c.574T>C, NM_014053.3:c.739-2delA600
FMR1Fragile X syndrome-(CGG)n pre-mutated allele (Detection by PCR and TP-PCR)250,600
FOXN1T-cell immunodeficiency, congenital alopecia, and nail dystrophyNM_003593.2NM_003593.2:c.763C>T600
FRAS1Fraser syndromeNM_025074.6NM_025074.6:c.7813C>T, NM_025074.6:c.832_835delTGTG, NM_025074.6:c.11159_11166delAGCTGGAG, NM_025074.6:c.776T>G, NM_025074.6:c.6991_6992insGG, NM_025074.6:c.6433C>T, NM_025074.6:c.3799C>T, NM_025074.6:c.1071+1_1071+4delGTGA, NM_025074.6:c.4969+1_4969+2insTAGC, NM_025074.6:c.5605_5606insT250,600
FREM2Fraser syndromeNM_207361.5NM_207361.5:c.2361_2362insC, NM_207361.5:c.8409+1G>A, NM_207361.5:c.5914G>A, NM_207361.5:c.5920G>A, NM_207361.5:c.3792_3795delTTAT600
FUCA1FucosidosisNM_000147.4NM_000147.4:c.244C>T, NM_000147.4:c.1279C>T, NM_000147.4:c.856C>T, NM_000147.4:c.648C>A, NM_000147.4:c.1229T>G, NM_000147.4:c.433T>C600
FXNFriedreich ataxiaNM_000144.4NM_000144.4:c.389G>T, NM_000144.4:c.460A>T, NM_000144.4:c.385-2A>G, NM_000144.4:c.317T>G600
G6PCGlycogen storage disease type 1aNM_000151.3NM_000151.3:c.508C>T, NM_000151.3:c.551G>A, NM_000151.3:c.447-1G>A, NM_000151.3:c.1039C>T, NM_000151.3:c.562G>C, NM_000151.3:c.380_381insTA, NM_000151.3:c.497T>G, NM_000151.3:c.247C>T, NM_000151.3:c.113A>T, NM_000151.3:c.229T>C, NM_000151.3:c.230+1G>C, NM_000151.3:c.47C>G, NM_000151.3:c.883C>T, NM_000151.3:c.370G>A, NM_000151.3:c.626A>G, NM_000151.3:c.248G>A250,600
G6PC3Severe congenital neutropenia type 4NM_138387.3NM_138387.3:c.346A>G, NM_138387.3:c.141C>G, NM_138387.3:c.778G>C, NM_138387.3:c.758G>A, NM_138387.3:c.935_936insT, NM_138387.3:c.784G>C600
GAAGlycogen storage disease type 2NM_000152.3NM_000152.3:c.118C>T, NM_000152.3:c.1316T>A, NM_000152.3:c.1799G>A, NM_000152.3:c.1827_1828insA, NM_000152.3:c.1846_1847insA, NM_000152.3:c.1115A>T, NM_000152.3:c.1552-3C>G, NM_000152.3:c.1445C>T, NM_000152.3:c.2238G>C, NM_000152.3:c.1327-2A>G, NM_000152.3:c.1650dupG, NM_000152.3:c.2238G>A, NM_000152.3:c.307T>G, NM_000152.3:c.230_240delCAGTGCCCACA, NM_000152.3:c.2512C>T, NM_000152.3:c.1431delT, NM_000152.3:c.1561G>A, NM_000152.3:c.1465G>A, NM_000152.3:c.1548G>A, NM_000152.3:c.546G>A, NM_000152.3:c.1064T>C, NM_000152.3:c.877G>A, NM_000152.3:c.925G>A, NM_000152.3:c.768_769insT, NM_000152.3:c.2560C>T, NM_000152.3:c.655G>A, NM_000152.3:c.1408_1410delAAC, NM_000152.3:c.953T>C, NM_000152.3:c.1933G>T, NM_000152.3:c.1935C>A, NM_000152.3:c.1585_1586delTCinsGT, NM_000152.3:c.1927G>A, NM_000152.3:c.2041-1G>A, NM_000152.3:c.2066_2070dupAGCCG, NM_000152.3:c.2105G>T, NM_000152.3:c.2237G>A, NM_000152.3:c.525delT, NM_000152.3:c.546+1_546+4delGTGG, NM_000152.3:c.2544delC, NM_000152.3:c.1912G>T, NM_000152.3:c.1634C>T, NM_000152.3:c.710C>T, NM_000152.3:c.2015G>A, NM_000152.3:c.546G>C, NM_000152.3:c.2012T>G, NM_000152.3:c.853C>T, NM_000152.3:c.697delA250,600
GALCKrabbe diseaseNM_000153.3NM_000153.3:c.1591C>T, NM_000153.3:c.1161+2T>G, NM_000153.3:c.1586C>T, NM_000153.3:c.1592G>A, NM_000153.3:c.1489+1_1489+2delGT, NM_000153.3:c.582+1G>A, NM_000153.3:c.388G>A, NM_000153.3:c.430delA, NM_000153.3:c.1695delT, NM_000153.3:c.1472delA, NM_000153.3:c.1004A>G, NM_000153.3:c.1153G>T, NM_000153.3:c.658C>T, NM_000153.3:c.1543G>A, NM_000153.3:c.332G>A, NM_000153.3:c.334A>G, NM_000153.3:c.205C>T, NM_000153.3:c.1796T>G, NM_000153.3:c.1814dupA, NM_000153.3:c.1700A>C, NM_000153.3:c.1723_1724insT, NM_000153.3:c.1964delC, NM_000153.3:c.236G>A, NM_000153.3:c.1488_1489+2delTGGT, NM_000153.3:c.453G>A, NM_000153.3:c.1488_1489delTG, NM_000153.3:c.628A>T, NM_000153.3:c.655C>T, NM_000153.3:c.953C>G, NM_000153.3:c.2056T>C250,600
GALTGalactosemiaNM_000155.3NM_000155.3:c.130G>A, NM_000155.3:c.132delG, NM_000155.3:c.118G>T, NM_000155.3:c.265T>G, NM_000155.3:c.289_291delAAC, NM_000155.3:c.1138T>C, NM_000155.3:c.113A>C, NM_000155.3:c.152G>A, NM_000155.3:c.1048delA, NM_000155.3:c.290A>G, NM_000155.3:c.221T>C, NM_000155.3:c.253-2A>G, NM_000155.3:c.425T>A, NM_000155.3:c.428C>T, NM_000155.3:c.442C>T, NM_000155.3:c.143G>C, NM_000155.3:c.443G>A, NM_000155.3:c.158G>A, NM_000155.3:c.18delC, NM_000155.3:c.199C>T, NM_000155.3:c.200G>A, NM_000155.3:c.203A>C, NM_000155.3:c.218_219delCT, NM_000155.3:c.512T>C, NM_000155.3:c.547C>A, NM_000155.3:c.552C>A, NM_000155.3:c.563A>G, NM_000155.3:c.565_578delGTATGGGCCAGCAG, NM_000155.3:c.568T>C, NM_000155.3:c.580T>C, NM_000155.3:c.584T>C, NM_000155.3:c.598delC, NM_000155.3:c.601C>T, NM_000155.3:c.602G>A, NM_000155.3:c.1030C>A, NM_000155.3:c.510C>A, NM_000155.3:c.617A>G, NM_000155.3:c.619C>T, NM_000155.3:c.626A>G, NM_000155.3:c.634C>T, NM_000155.3:c.688-2A>C, NM_000155.3:c.692G>A, NM_000155.3:c.292G>A, NM_000155.3:c.329-2A>C, NM_000155.3:c.367C>T, NM_000155.3:c.377+7A>C, NM_000155.3:c.386T>C, NM_000155.3:c.607G>A, NM_000155.3:c.610C>T, NM_000155.3:c.413C>T, NM_000155.3:c.416T>G, NM_000155.3:c.41delinsTT, NM_000155.3:c.904+1G>T, NM_000155.3:c.905-2A>G, NM_000155.3:c.907G>A, NM_000155.3:c.442G>A, NM_000155.3:c.947G>A, NM_000155.3:c.443G>C, NM_000155.3:c.445dupG, NM_000155.3:c.997C>G, NM_000155.3:c.997C>T, NM_000155.3:c.998G>A, NM_000155.3:c.793C>G, NM_000155.3:c.820+13A>G, NM_000155.3:c.1052delC, NM_000155.3:c.844C>G, NM_000155.3:c.855G>T, NM_000155.3:c.719_728delTAGTACTGGT, NM_000155.3:c.772C>T, NM_000155.3:c.939G>A, NM_000155.3:c.71_72insA, NM_000155.3:c.404C>T, NM_000155.3:c.508-1G>C, NM_000155.3:c.775C>T, NM_000155.3:c.400delT, NM_000155.3:c.502_504delGTG, NM_000155.3:c.957C>A, NM_000155.3:c.823C>G, NM_000155.3:c.505C>A, NM_000155.3:c.1006A>T, NM_000155.3:c.985T>C, NM_000155.3:c.790delC, NM_000155.3:c.790_792delinsTAG250,600
GAMTGuanidinoacetate methyltransferase deficiencyNM_000156.5NM_000156.5:c.506G>A, NM_000156.5:c.590T>C600
GANGiant axonal neuropathyNM_022041.3NM_022041.3:c.1447C>T, NM_022041.3:c.1456G>A, NM_022041.3:c.1684C>G, NM_022041.3:c.1429C>T, NM_022041.3:c.601C>T, NM_022041.3:c.413G>A, NM_022041.3:c.505G>A, NM_022041.3:c.1268T>C250,600
GBAGaucher diseaseNM_001005741.2NM_001005741.2:c.1093G>A, NM_001005741.2:c.1090G>A, NM_001005741.2:c.1043C>T, NM_001005741.2:c.1274dupA, NM_001005741.2:c.1098dupA, NM_001005741.2:c.1085C>T, NM_001005741.2:c.1102C>T, NM_001005741.2:c.1049A>G, NM_001005741.2:c.1240G>T, NM_001005741.2:c.1246G>A, NM_001005741.2:c.1301G>C, NM_001005741.2:c.1088T>C, NM_001005741.2:c.1348T>A, NM_001005741.2:c.1361C>G, NM_001005741.2:c.1342G>C, NM_001005741.2:c.1448T>C, NM_001005741.2:c.1448T>G, NM_001005741.2:c.1504C>T, NM_001005741.2:c.1447_1466delCTGGACGCAGTGGCACTGATinsTG, NM_001005741.2:c.254G>A, NM_001005741.2:c.259C>T, NM_001005741.2:c.1053G>T, NM_001005741.2:c.160G>T, NM_001005741.2:c.431T>G, NM_001005741.2:c.475C>T, NM_001005741.2:c.476G>A, NM_001005741.2:c.481C>T, NM_001005741.2:c.487delG, NM_001005741.2:c.497A>T, NM_001005741.2:c.508C>T, NM_001005741.2:c.1141T>G, NM_001005741.2:c.115+1G>A, NM_001005741.2:c.1171G>C, NM_001005741.2:c.1174C>G, NM_001005741.2:c.354G>C, NM_001005741.2:c.1060G>C, NM_001005741.2:c.1208G>C, NM_001005741.2:c.1228C>G, NM_001005741.2:c.123A>G, NM_001005741.2:c.1240G>C, NM_001005741.2:c.914delC, NM_001005741.2:c.517A>C, NM_001005741.2:c.1295G>T, NM_001005741.2:c.1307T>C, NM_001005741.2:c.1265_1319del, NM_001005741.2:c.1319C>T, NM_001005741.2:c.1309G>T, NM_001005741.2:c.1226A>G, NM_001005741.2:c.407C>A, NM_001005741.2:c.1343A>T, NM_001005741.2:c.84_85insG, NM_001005741.2:c.518C>T, NM_001005741.2:c.1391A>C, NM_001005741.2:c.509G>T, NM_001005741.2:c.1604G>A, NM_001005741.2:c.84dupG, NM_001005741.2:c.535G>C, NM_001005741.2:c.586A>C, NM_001005741.2:c.1297G>T, NM_001005741.2:c.1184C>T, NM_001005741.2:c.1192C>T250,600
GBE1Glycogen storage disease type 4NM_000158.3NM_000158.3:c.1571G>A, NM_000158.3:c.1570C>T, NM_000158.3:c.1774G>T, NM_000158.3:c.771T>A, NM_000158.3:c.1543C>T, NM_000158.3:c.1883A>G, NM_000158.3:c.2052+1G>A, NM_000158.3:c.986A>C, NM_000158.3:c.466_470delCGTAT, NM_000158.3:c.1604A>G250,600
GBE1Polyglucosan body disease, adultNM_000158.3NM_000158.3:c.986A>G250,600
GCDHGlutaric acidemia type 1NM_000159.3NM_000159.3:c.1093G>A, NM_000159.3:c.1060G>C, NM_000159.3:c.542A>G, NM_000159.3:c.442G>A, NM_000159.3:c.1199dupT, NM_000159.3:c.572T>C, NM_000159.3:c.1060G>A, NM_000159.3:c.1247C>T, NM_000159.3:c.74C>A, NM_000159.3:c.947C>A, NM_000159.3:c.1168G>C, NM_000159.3:c.416C>T, NM_000159.3:c.1198G>A, NM_000159.3:c.636-1G>A, NM_000159.3:c.1204C>T, NM_000159.3:c.1244-2A>C, NM_000159.3:c.751C>T, NM_000159.3:c.1262C>T, NM_000159.3:c.1148G>A, NM_000159.3:c.680G>C, NM_000159.3:c.883T>C, NM_000159.3:c.1015A>G, NM_000159.3:c.764C>T, NM_000159.3:c.271+1G>A, NM_000159.3:c.743C>T, NM_000159.3:c.877G>A, NM_000159.3:c.914C>T, NM_000159.3:c.1002_1003delGA, NM_000159.3:c.383G>A, NM_000159.3:c.769C>T250,600
GCSHGlycine encephalopathy (GCSH)NM_004483.4NM_004483.4:c.337dupT600
GDAP1Charcot-Marie-Tooth disease type 4ANM_018972.2NM_018972.2:c.358C>T, NM_018972.2:c.487C>T, NM_018972.2:c.311-1G>A, NM_018972.2:c.844C>T, NM_018972.2:c.715C>T, NM_018972.2:c.92G>A600
GFM1Combined oxidative phosphorylation deficiency type 1NM_024996.5NM_024996.5:c.1294_1297delACAG, NM_024996.5:c.748C>T, NM_024996.5:c.139C>T, NM_024996.5:c.1528_1529delAG, NM_024996.5:c.521A>G600
GJA1Oculodentodigital dysplasiaNM_000165.4NM_000165.4:c.227G>A, NM_000165.4:c.97C>T600
GJB2Deafness type 1A, autosomal recessiveNM_004004.5NM_004004.5:c.176_191delGCTGCAAGAACGTGTG, NM_004004.5:c.169C>T, NM_004004.5:c.270dupA, NM_004004.5:c.239A>C, NM_004004.5:c.269T>C, NM_004004.5:c.427C>T, NM_004004.5:c.299_300delAT, NM_004004.5:c.250G>T, NM_004004.5:c.230G>A, NM_004004.5:c.516G>A, NM_004004.5:c.439G>A, NM_004004.5:c.465T>A, NM_004004.5:c.229T>C, NM_004004.5:c.241C>G, NM_004004.5:c.235delC, NM_004004.5:c.238C>T, NM_004004.5:c.557C>T, NM_004004.5:c.269_270insT, NM_004004.5:c.617A>G, NM_004004.5:c.231G>A, NM_004004.5:c.310_323delAGGAAGTTCATCAA, NM_004004.5:c.313_326delAAGTTCATCAAGGG, NM_004004.5:c.358_360delGAG, NM_004004.5:c.35delG, NM_004004.5:c.249C>G, NM_004004.5:c.334_335delAA, NM_004004.5:c.402delG, NM_004004.5:c.413G>A, NM_004004.5:c.416G>A, NM_004004.5:c.299A>T, NM_004004.5:c.250G>C, NM_004004.5:c.550C>T, NM_004004.5:c.551G>C, NM_004004.5:c.503A>G, NM_004004.5:c.227T>C, NM_004004.5:c.380G>A, NM_004004.5:c.132G>A, NM_004004.5:c.365A>T, NM_004004.5:c.139G>T250,600
GJB3Deafness type 1A, autosomal recessiveNM_024009.2NM_024009.2:c.529T>G, NM_024009.2:c.580G>A, NM_024009.2:c.94C>T250,600
GJB6Deafness type 1B, autosomal recessiveNM_006783.4NM_006783.4:c.261dupA, NM_006783.4:c.169C>T, NM_006783.4:c.485dupA, NM_006783.4:c.689dupA, NM_006783.4:c.14C>T, NM_006783.4:c.443delC, NM_006783.4:c.383_384delTA, NM_006783.4:c.689_690insA250,600
GJC2Pelizaeus-Merzbacher-like disease type 1NM_020435.3NM_020435.3:c.857T>C, NM_020435.3:c.814T>G, NM_020435.3:c.613C>T, NM_020435.3:c.787G>A, NM_020435.3:c.718C>T, NM_020435.3:c.268C>T600
GLB1GM1 GangliosidosisNM_000404.2NM_000404.2:c.1369C>T, NM_000404.2:c.1370G>A, NM_000404.2:c.1452C>G, NM_000404.2:c.176G>A, NM_000404.2:c.276G>A, NM_000404.2:c.1733A>G, NM_000404.2:c.1355dupA, NM_000404.2:c.442C>A, NM_000404.2:c.202C>T, NM_000404.2:c.591_592insT, NM_000404.2:c.622C>T, NM_000404.2:c.1549G>T, NM_000404.2:c.442C>T, NM_000404.2:c.457+2T>C, NM_000404.2:c.947A>G, NM_000404.2:c.438_440delTCT, NM_000404.2:c.601C>T, NM_000404.2:c.602G>A, NM_000404.2:c.1068+1G>T, NM_000404.2:c.1174_1175delCT, NM_000404.2:c.1004C>T, NM_000404.2:c.1051C>T, NM_000404.2:c.171C>G, NM_000404.2:c.1321G>A, NM_000404.2:c.1325G>A, NM_000404.2:c.818G>T, NM_000404.2:c.152T>C, NM_000404.2:c.1456_1466dupGGTGCATATAT, NM_000404.2:c.145C>T, NM_000404.2:c.175C>T, NM_000404.2:c.901G>A, NM_000404.2:c.1646C>T, NM_000404.2:c.1577dupG, NM_000404.2:c.1310A>T250,600
GLB1Mucopolysaccharidosis type 4BNM_000404.2NM_000404.2:c.1444C>T, NM_000404.2:c.1313G>A, NM_000404.2:c.817T>C, NM_000404.2:c.1445G>A, NM_000404.2:c.1223A>C250,600
GLDCGlycine encephalopathyNM_000170.2NM_000170.2:c.322G>T, NM_000170.2:c.1229G>A, NM_000170.2:c.1545G>C, NM_000170.2:c.1691G>T, NM_000170.2:c.1166C>T, NM_000170.2:c.2113G>A, NM_000170.2:c.2284G>A, NM_000170.2:c.1705G>A, NM_000170.2:c.2216G>A, NM_000170.2:c.2405C>T250,600
GLE1Lethal arthrogryposis with anterior horn cell diseaseNM_001003722.1NM_001003722.1:c.2051T>C, NM_001003722.1:c.1412_1413delAG, NM_001003722.1:c.898-2A>G, NM_001003722.1:c.2069_2072delTTCT, NM_001003722.1:c.1807C>T250,600
GM2AGM2 GangliosidosisNM_000405.4NM_000405.4:c.285delC, NM_000405.4:c.160G>T, NM_000405.4:c.506G>C600
GNEDistal myopathy Nonaka typeNM_005476.5NM_005476.5:c.2116T>C, NM_005476.5:c.2135T>C, NM_005476.5:c.2086G>A, NM_005476.5:c.478C>T, NM_005476.5:c.1844C>G, NM_005476.5:c.737G>A, NM_005476.5:c.385C>T, NM_005476.5:c.1714G>T, NM_005476.5:c.1798G>A, NM_005476.5:c.2086G>T, NM_005476.5:c.787C>T, NM_005476.5:c.2023T>C, NM_005476.5:c.1993G>A, NM_005476.5:c.673G>A, NM_005476.5:c.909T>A, NM_005476.5:c.1727G>A250,600
GNPTABMucolipidosis type 2/type 3NM_024312.4NM_024312.4:c.1931C>T, NM_024312.4:c.1799delC, NM_024312.4:c.3503_3504delTC, NM_024312.4:c.3173C>G, NM_024312.4:c.25C>T, NM_024312.4:c.3663delG, NM_024312.4:c.1906dupA, NM_024312.4:c.2383delG, NM_024312.4:c.732_733delAA, NM_024312.4:c.749dupA, NM_024312.4:c.2896delA, NM_024312.4:c.648_651delAGAA, NM_024312.4:c.3326dupA, NM_024312.4:c.3410T>A, NM_024312.4:c.10A>C, NM_024312.4:c.1000C>T, NM_024312.4:c.1196C>T, NM_024312.4:c.1759C>T, NM_024312.4:c.3565C>T, NM_024312.4:c.616_619delACAG, NM_024312.4:c.99delC, NM_024312.4:c.3598G>A, NM_024312.4:c.3560_3561delAG250,600
GNSMucopolysaccharidosis type 3DNM_002076.3NM_002076.3:c.1063C>T, NM_002076.3:c.1226dupG, NM_002076.3:c.1169delA, NM_002076.3:c.1168C>T, NM_002076.3:c.413C>G600
GPR143Ocular albinism, X-linkedNM_000273.2NM_000273.2:c.992_993insCG, NM_000273.2:c.695C>A600
GPR179Night blindness, congenital stationary type 1ENM_001004334.3NM_001004334.3:c.1784+1G>A, NM_001004334.3:c.1368delT, NM_001004334.3:c.3656_3657delCT, NM_001004334.3:c.6847_6848delCT, NM_001004334.3:c.984delC, NM_001004334.3:c.1807C>T, NM_001004334.3:c.278_279insC, NM_001004334.3:c.5693_5694insT, NM_001004334.3:c.278delC, NM_001004334.3:c.1236G>A, NM_001004334.3:c.376G>C, NM_001004334.3:c.3233_3234delCT, NM_001004334.3:c.5763_5764delGA, NM_001004334.3:c.839_842delATCA, NM_001004334.3:c.4699_4700delAG250,600
GPR98Usher syndrome type 2CNM_032119.3NM_032119.3:c.11377G>T, NM_032119.3:c.8713_8716dupAACA, NM_032119.3:c.2864C>A, NM_032119.3:c.18131A>G, NM_032119.3:c.2258_2270delAAGTGCTGAAATC, NM_032119.3:c.6275-1G>A, NM_032119.3:c.2636C>T, NM_032119.3:c.14973-1G>C, NM_032119.3:c.17668_17669delAT, NM_032119.3:c.5357_5358delAA, NM_032119.3:c.5747C>T, NM_032119.3:c.15196_15199dupCAAA, NM_032119.3:c.3151G>T, NM_032119.3:c.6901C>T, NM_032119.3:c.8790delC, NM_032119.3:c.5830G>A, NM_032119.3:c.6311_6312insT250,600
GRHPRPrimary hyperoxaluria type 2NM_012203.1NM_012203.1:c.103delG, NM_012203.1:c.295C>T, NM_012203.1:c.755dupA, NM_012203.1:c.622C>T, NM_012203.1:c.435G>A600
GRM6Night blindness, congenital stationary type 1BNM_000843.3NM_000843.3:c.2341G>A, NM_000843.3:c.727_728insG, NM_000843.3:c.2213_2219delCCAGAGG, NM_000843.3:c.1861C>T, NM_000843.3:c.2560C>T, NM_000843.3:c.712C>T, NM_000843.3:c.2122C>T, NM_000843.3:c.719_720insG, NM_000843.3:c.1214T>C, NM_000843.3:c.1336C>T, NM_000843.3:c.1258C>T, NM_000843.3:c.1565G>A250,600
GRXCR1Deafness type 25, autosomal recessiveNM_001080476.2NM_001080476.2:c.229C>T, NM_001080476.2:c.190G>A, NM_001080476.2:c.710_711delAT600
GSSGlutathione synthetase deficiencyNM_000178.2NM_000178.2:c.656A>G, NM_000178.2:c.847C>T, NM_000178.2:c.754C>T, NM_000178.2:c.799C>T, NM_000178.2:c.4delG, NM_000178.2:c.656A>C, NM_000178.2:c.491G>A, NM_000178.2:c.832C>T600
GUCY2DLeber congenital amaurosis type 1NM_000180.3NM_000180.3:c.1694T>C, NM_000180.3:c.2735_2736delTT, NM_000180.3:c.456C>A, NM_000180.3:c.622delC, NM_000180.3:c.2734_2735delTT, NM_000180.3:c.2945delG600
GUSBMucopolysaccharidosis type 7NM_000181.3NM_000181.3:c.1065+1G>T, NM_000181.3:c.1084G>A, NM_000181.3:c.1144C>T, NM_000181.3:c.1337G>A, NM_000181.3:c.1222C>T, NM_000181.3:c.1730G>T, NM_000181.3:c.1831C>T, NM_000181.3:c.1856C>T, NM_000181.3:c.1881G>T, NM_000181.3:c.442C>T, NM_000181.3:c.499C>T, NM_000181.3:c.526C>T, NM_000181.3:c.646C>T, NM_000181.3:c.820_821delAC, NM_000181.3:c.1061C>T, NM_000181.3:c.1050G>C, NM_000181.3:c.1534G>A, NM_000181.3:c.1244C>T, NM_000181.3:c.1219_1220insC, NM_000181.3:c.866G>A, NM_000181.3:c.1244+1G>A, NM_000181.3:c.1521G>A, NM_000181.3:c.1429C>T, NM_000181.3:c.1618G>T, NM_000181.3:c.1338G>A250,600
HADHATrifunctional protein deficiencyNM_000182.4NM_000182.4:c.1918C>T, NM_000182.4:c.274_278delTCATC, NM_000182.4:c.2131C>A, NM_000182.4:c.1793_1794delAT, NM_000182.4:c.1620+2_1620+6delTAAGG, NM_000182.4:c.2027G>A, NM_000182.4:c.1678C>T, NM_000182.4:c.2132_2133insC, NM_000182.4:c.2146+1G>A, NM_000182.4:c.919-2A>G, NM_000182.4:c.1644delC, NM_000182.4:c.1132C>T, NM_000182.4:c.1528G>C, NM_000182.4:c.499delA, NM_000182.4:c.845T>A, NM_000182.4:c.1422dupT250,600
HADHBTrifunctional protein deficiencyNM_000183.2NM_000183.2:c.788A>G, NM_000183.2:c.1364T>G, NM_000183.2:c.1331G>A600
HALHistidinemiaNM_002108.3NM_002108.3:c.890_891insT, NM_002108.3:c.146_152delATGACGC, NM_002108.3:c.1287+2T>C, NM_002108.3:c.102_103insGC, NM_002108.3:c.903+1G>A600
HBAAlpha-thalassemia---MED, --SEA, --THAI, -?4.2, -?3.7, --FIL, -(?)20.5 (Detection by PCR)600
HBBBeta-thalassemiaNM_000518.4NM_000518.4:c.135delC, NM_000518.4:c.118C>T, NM_000518.4:c.217dupA, NM_000518.4:c.92+5G>C, NM_000518.4:c.208G>A, NM_000518.4:c.85_86insC, NM_000518.4:c.92+5G>A, NM_000518.4:c.27dupG, NM_000518.4:c.126_129delCTTT, NM_000518.4:c.93-23T>C, NM_000518.4:c.92+1G>A, NM_000518.4:c.82G>T, NM_000518.4:c.315+1G>A, NM_000518.4:c.52A>T, NM_000518.4:c.380T>A, NM_000518.4:c.93-21G>A, NM_000518.4:c.79G>A, NM_000518.4:c.112delT, NM_000518.4:c.92+6T>C, NM_000518.4:c.59A>G, NM_000518.4:c.364G>A250,600
HBBSickle cell anaemiaNM_000518.4NM_000518.4:c.19G>A, NM_000518.4:c.20A>T250,600
HESX1Combined pituitary hormone deficiencies, genetic formsNM_003865.2NM_003865.2:c.374A>G, NM_003865.2:c.77T>C, NM_003865.2:c.445G>A, NM_003865.2:c.450_451delCA, NM_003865.2:c.18G>C250,600
HEXATay-Sachs diseaseNM_000520.4NM_000520.4:c.1176G>A, NM_000520.4:c.1495C>T, NM_000520.4:c.1177C>T, NM_000520.4:c.116T>G, NM_000520.4:c.1510delC, NM_000520.4:c.1496G>A, NM_000520.4:c.1260G>C, NM_000520.4:c.1351C>G, NM_000520.4:c.1511G>A, NM_000520.4:c.1499delT, NM_000520.4:c.1510C>T, NM_000520.4:c.380T>G, NM_000520.4:c.459+5G>A, NM_000520.4:c.508C>T, NM_000520.4:c.509G>A, NM_000520.4:c.532C>T, NM_000520.4:c.533G>A, NM_000520.4:c.533G>T, NM_000520.4:c.1528C>T, NM_000520.4:c.173G>A, NM_000520.4:c.1A>G, NM_000520.4:c.1A>T, NM_000520.4:c.1444G>A, NM_000520.4:c.1453T>C, NM_000520.4:c.739C>T, NM_000520.4:c.745C>T, NM_000520.4:c.749G>A, NM_000520.4:c.759_774dupGCTTGCAGAGTTTGAC, NM_000520.4:c.772G>C, NM_000520.4:c.1214_1215delinsG, NM_000520.4:c.78G>A, NM_000520.4:c.538T>C, NM_000520.4:c.540C>G, NM_000520.4:c.805G>A, NM_000520.4:c.915_917delCTT, NM_000520.4:c.254-1G>C, NM_000520.4:c.2T>C, NM_000520.4:c.1537C>T, NM_000520.4:c.1490A>G, NM_000520.4:c.77G>A, NM_000520.4:c.1422G>C, NM_000520.4:c.805+1G>A, NM_000520.4:c.805+1G>C, NM_000520.4:c.672+1G>A, NM_000520.4:c.629C>T, NM_000520.4:c.987G>A, NM_000520.4:c.632T>C, NM_000520.4:c.1278_1279insTATC, NM_000520.4:c.1274_1277dupTATC, NM_000520.4:c.986+3A>G, NM_000520.4:c.611A>G, NM_000520.4:c.1277_1278insTAT250,600
HEXBSandhoff diseaseNM_000521.3NM_000521.3:c.1310_1311delCA, NM_000521.3:c.1380G>A, NM_000521.3:c.1367A>C, NM_000521.3:c.1238_1242delCAAAG, NM_000521.3:c.298delC, NM_000521.3:c.1345delT, NM_000521.3:c.797A>G, NM_000521.3:c.1539_1540delCT, NM_000521.3:c.1375G>T, NM_000521.3:c.508C>T, NM_000521.3:c.1517_1529dupCAAGTGCTGTTGG, NM_000521.3:c.841C>T, NM_000521.3:c.202_203insGG, NM_000521.3:c.1250C>T, NM_000521.3:c.1619_1620insTTCATGTTATCTACAGACGTG, NM_000521.3:c.1537_1538delCT, NM_000521.3:c.170delG, NM_000521.3:c.115delG, NM_000521.3:c.171delG, NM_000521.3:c.850C>T250,600
HFEHaemochromatosisNM_000410.3NM_000410.3:c.18G>C, NM_000410.3:c.252G>A, NM_000410.3:c.989G>T, NM_000410.3:c.314T>C, NM_000410.3:c.193A>T, NM_000410.3:c.829G>A, NM_000410.3:c.277G>C250,600
HGDAlkaptonuriaNM_000187.3NM_000187.3:c.140C>T, NM_000187.3:c.16-1G>A, NM_000187.3:c.342+1G>A, NM_000187.3:c.1111_1112insC, NM_000187.3:c.899T>G, NM_000187.3:c.1189-2A>G, NM_000187.3:c.674G>A, NM_000187.3:c.175delA, NM_000187.3:c.283-5delT, NM_000187.3:c.172A>T, NM_000187.3:c.873C>A, NM_000187.3:c.283-4C>T, NM_000187.3:c.808G>A, NM_000187.3:c.1102A>G, NM_000187.3:c.469+2T>C, NM_000187.3:c.688C>T, NM_000187.3:c.481G>A250,600
HGFDeafness type 39, autosomal recessiveNM_000601.4NM_000601.4:c.2028delA, NM_000601.4:c.1597C>T600
HGSNATMucopolysaccharidosis type 3CNM_152419.2NM_152419.2:c.1378-1G>A, NM_152419.2:c.1843G>A, NM_152419.2:c.607C>T, NM_152419.2:c.1250+1G>A, NM_152419.2:c.848C>T, NM_152419.2:c.1464+1G>A, NM_152419.2:c.1501delA, NM_152419.2:c.1030C>T, NM_152419.2:c.1503delA, NM_152419.2:c.1553C>T, NM_152419.2:c.1622C>T, NM_152419.2:c.493+1G>A250,600
HIBCH3-Hydroxyisobutryl-CoA hydrolase deficiencyNM_014362.3NM_014362.3:c.1012A>T, NM_014362.3:c.79-3C>G, NM_014362.3:c.494_495delTT, NM_014362.3:c.365A>G, NM_014362.3:c.220-9T>G600
HMGCL3-hydroxy-3-methylglutaric aciduriaNM_000191.2NM_000191.2:c.835G>A, NM_000191.2:c.230delT, NM_000191.2:c.122G>A, NM_000191.2:c.698A>G, NM_000191.2:c.206_207delCT, NM_000191.2:c.505_506delTC600
HPDTyrosinemia type 3NM_002150.2NM_002150.2:c.600C>G, NM_002150.2:c.774T>G, NM_002150.2:c.1005C>G, NM_002150.2:c.987delA250,600
HPRT1Lesch-Nyhan syndromeNM_000194.2NM_000194.2:c.486-1G>A, NM_000194.2:c.508C>T, NM_000194.2:c.610-2A>G, NM_000194.2:c.532+2T>G600
HPS1Hermansky-Pudlak syndrome type 1NM_000195.3NM_000195.3:c.972_973insC, NM_000195.3:c.972delC, NM_000195.3:c.1996G>T, NM_000195.3:c.398+5G>A, NM_000195.3:c.1472_1487dupCCAGCAGGGGAGGCCC, NM_000195.3:c.397G>T600
HSD17B4D-bifunctional protein deficiencyNM_000414.3NM_000414.3:c.1369A>T, NM_000414.3:c.46G>A, NM_000414.3:c.972+1G>T, NM_000414.3:c.317G>C600
HSD17B4Perrault syndromeNM_000414.3NM_000414.3:c.650A>G600
HSPD1Leukodystrophy hypomyelinating type 4NM_002156.4NM_002156.4:c.292G>A600
HSPG2Schwartz-Jampel syndrome type 1NM_005529.6NM_005529.6:c.13075delC, NM_005529.6:c.1653_1654insT, NM_005529.6:c.10355G>A, NM_005529.6:c.1125C>A, NM_005529.6:c.9326delA, NM_005529.6:c.8464+4A>G600
HTRA1CARASIL syndromeNM_002775.4NM_002775.4:c.1108C>T, NM_002775.4:c.883G>A, NM_002775.4:c.904C>T, NM_002775.4:c.754G>A, NM_002775.4:c.889G>A600
HYLS1Hydrolethalus syndrome type 1NM_145014.2NM_145014.2:c.632A>G, NM_145014.2:c.724C>T, NM_145014.2:c.669G>A600
IDH3BRetinitis pigmentosa type 46NM_006899.3NM_006899.3:c.395T>C, NM_006899.3:c.490C>T, NM_006899.3:c.589delA600
IDSMucopolysaccharidosis type 2NM_000202.6NM_000202.6:c.1464G>T, NM_000202.6:c.1466G>C, NM_000202.6:c.1505G>C, NM_000202.6:c.283A>G, NM_000202.6:c.208dupC, NM_000202.6:c.596_599delAACA, NM_000202.6:c.597delA, NM_000202.6:c.683C>T, NM_000202.6:c.1148delC, NM_000202.6:c.880-8A>G, NM_000202.6:c.937C>T, NM_000202.6:c.998C>T, NM_000202.6:c.690_691insT, NM_000202.6:c.1122C>T, NM_000202.6:c.587T>C, NM_000202.6:c.314_317dupTCAA, NM_000202.6:c.278delC, NM_000202.6:c.514C>T, NM_000202.6:c.1508T>A, NM_000202.6:c.388_389insG, NM_000202.6:c.240+1G>A, NM_000202.6:c.404A>G600
IFT80Short-rib thoracic dysplasia type 2 with or without polydactylyNM_020800.2NM_020800.2:c.701C>G, NM_020800.2:c.721G>C, NM_020800.2:c.315C>G600
IGF1Growth delay due to insulin-like growth factor type 1 deficiencyNM_000618.3NM_000618.3:c.274G>A600
IGHMBP2Spinal muscular atrophy, distal, type 1, autosomal recessiveNM_002180.2NM_002180.2:c.1488C>A, NM_002180.2:c.2611+1G>T, NM_002180.2:c.1540G>A, NM_002180.2:c.1738G>A, NM_002180.2:c.661delA, NM_002180.2:c.121C>T, NM_002180.2:c.1101_1116delCTACTTCGACGTGGTG, NM_002180.2:c.2922T>G, NM_002180.2:c.1107C>G, NM_002180.2:c.2362C>T, NM_002180.2:c.638A>G250,600
IKBKAPFamilial dysautonomiaNM_003640.3NM_003640.3:c.3332delC, NM_003640.3:c.1460+2T>C, NM_003640.3:c.2204+6T>C, NM_003640.3:c.2328delT, NM_003640.3:c.2741C>T, NM_003640.3:c.2087G>C, NM_003640.3:c.2087G>A600
IL2RGSevere combined immunodeficiency T-B+; X-linkedNM_000206.2NM_000206.2:c.454+1G>A, NM_000206.2:c.452T>C, NM_000206.2:c.186T>A, NM_000206.2:c.664C>T, NM_000206.2:c.343T>C, NM_000206.2:c.854G>A, NM_000206.2:c.341G>A, NM_000206.2:c.355A>T600
IMPDH1Retinitis pigmentosa type 10NM_000883.3NM_000883.3:c.1057G>A, NM_000883.3:c.1390delC, NM_000883.3:c.931G>A250,600
IMPG2Retinitis pigmentosa type 56NM_016247.3NM_016247.3:c.635C>G, NM_016247.3:c.3262C>T, NM_016247.3:c.502-1G>C, NM_016247.3:c.2890C>T600
INPP5EJoubert syndrome type 1NM_019892.4NM_019892.4:c.1132C>T, NM_019892.4:c.855_856insCG, NM_019892.4:c.1688G>A, NM_019892.4:c.1543C>T, NM_019892.4:c.1304G>A250,600
INPP5EMORM syndromeNM_019892.4NM_019892.4:c.1879C>T250,600
INSRDiabetes mellitus, insulin-resistantNM_000208.2NM_000208.2:c.3079C>T, NM_000208.2:c.3680G>C, NM_000208.2:c.3034G>A, NM_000208.2:c.1114C>T, NM_000208.2:c.1378A>G250,600
INSRLeprechaunismNM_000208.2NM_000208.2:c.2668C>T, NM_000208.2:c.172G>A250,600
IQCB1Senior-Loken syndrome type 5NM_001023570.2NM_001023570.2:c.1036G>T, NM_001023570.2:c.817G>T, NM_001023570.2:c.1381C>T, NM_001023570.2:c.1465C>T, NM_001023570.2:c.1090C>T, NM_001023570.2:c.1518_1519delCA, NM_001023570.2:c.1069C>T600
ISCUMyopathy with deficiency of ISCUNM_213595.3NM_213595.3:c.338_339+2delCGGT, NM_213595.3:c.149G>A600
ITGA6Epidermolysis bullosa, junctional with pyloric atresiaNM_000210.2NM_000210.2:c.791delC, NM_000210.2:c.1255dupA600
ITGB4Epidermolysis bullosa, junctional with pyloric atresiaNM_001005731.1NM_001005731.1:c.112T>C, NM_001005731.1:c.1684T>C, NM_001005731.1:c.1150delG, NM_001005731.1:c.1544G>A, NM_001005731.1:c.3977-19T>A, NM_001005731.1:c.4410delG, NM_001005731.1:c.4433G>A, NM_001005731.1:c.5119+2T>C, NM_001005731.1:c.3321_3331delACTGGACCGGA, NM_001005731.1:c.4618C>T, NM_001005731.1:c.182G>A, NM_001005731.1:c.2607delC, NM_001005731.1:c.3801_3802insT, NM_001005731.1:c.3841C>T, NM_001005731.1:c.2608delC, NM_001005731.1:c.3793+1G>A, NM_001005731.1:c.1660C>T, NM_001005731.1:c.3674G>A250,600
ITGB4Epidermolysis bullosa, without pyloric atresiaNM_001005731.1NM_001005731.1:c.2792G>A250,600
IVDIsovaleric acidemiaNM_002225.3NM_002225.3:c.158G>C, NM_002225.3:c.1208A>G, NM_002225.3:c.157C>T, NM_002225.3:c.1141T>C, NM_002225.3:c.243+1G>A, NM_002225.3:c.1147+1_1147+4delGTGA, NM_002225.3:c.367G>A, NM_002225.3:c.605G>T, NM_002225.3:c.1145_1147+4delTTGGTGA, NM_002225.3:c.559+1G>A, NM_002225.3:c.134T>C, NM_002225.3:c.941C>T, NM_002225.3:c.627delT, NM_002225.3:c.793+1G>A, NM_002225.3:c.2T>G, NM_002225.3:c.1183C>T, NM_002225.3:c.390delT, NM_002225.3:c.406_407delTG, NM_002225.3:c.158G>A, NM_002225.3:c.593G>A, NM_002225.3:c.507delG, NM_002225.3:c.1188delT, NM_002225.3:c.465+2T>C, NM_002225.3:c.434_437dupATGA, NM_002225.3:c.860G>A, NM_002225.3:c.994_995delAT, NM_002225.3:c.1192C>T, NM_002225.3:c.478_479insGT250,600
JAK3Severe combined immunodeficiency T-B+NK-NM_000215.3NM_000215.3:c.452C>G, NM_000215.3:c.1765G>A, NM_000215.3:c.1333C>T, NM_000215.3:c.1172_1173insG, NM_000215.3:c.1837C>T, NM_000215.3:c.299A>G, NM_000215.3:c.1695C>A250,600
KCNJ1Bartter syndrome type 2NM_000220.4NM_000220.4:c.1012C>T, NM_000220.4:c.1070T>C, NM_000220.4:c.592G>A, NM_000220.4:c.322G>C, NM_000220.4:c.372T>A, NM_000220.4:c.500G>A, NM_000220.4:c.237C>G, NM_000220.4:c.1014delA, NM_000220.4:c.641C>T, NM_000220.4:c.657C>G, NM_000220.4:c.996_999delAAAG, NM_000220.4:c.942T>G250,600
KCNJ13Leber congenital amaurosis type 16NM_002242.4NM_002242.4:c.722T>C600
KCNV2Retinal cone dystrophy type 3BNM_133497.3NM_133497.3:c.1016_1024delACCTGGTGG, NM_133497.3:c.1376G>A, NM_133497.3:c.427G>T, NM_133497.3:c.226C>T, NM_133497.3:c.325C>T, NM_133497.3:c.357_358insC, NM_133497.3:c.1480A>C, NM_133497.3:c.1132_1133insT, NM_133497.3:c.854T>G, NM_133497.3:c.491T>C, NM_133497.3:c.767C>G, NM_133497.3:c.916G>T, NM_133497.3:c.778A>T, NM_133497.3:c.442G>T250,600
KIF7Acrocallosal syndromeNM_198525.2NM_198525.2:c.2473G>T, NM_198525.2:c.687delG, NM_198525.2:c.3001C>T, NM_198525.2:c.460C>T, NM_198525.2:c.61C>T, NM_198525.2:c.2896_2897delGC, NM_198525.2:c.3778_3779insC600
L1CAMMASA sindrome/hydrocephalusNM_000425.4NM_000425.4:c.3489_3490delTG, NM_000425.4:c.3201T>G, NM_000425.4:c.719C>T, NM_000425.4:c.3581C>T, NM_000425.4:c.2879delA, NM_000425.4:c.791G>A, NM_000425.4:c.2092G>A, NM_000425.4:c.924C>T, NM_000425.4:c.536T>G, NM_000425.4:c.23delT, NM_000425.4:c.2254G>A, NM_000425.4:c.800dupA, NM_000425.4:c.772C>T, NM_000425.4:c.1354G>A, NM_000425.4:c.551G>A, NM_000425.4:c.1792G>A, NM_000425.4:c.1108G>A600
LAMA2Congenital muscular dystrophy type 1ANM_000426.3NM_000426.3:c.184G>T, NM_000426.3:c.1612C>T, NM_000426.3:c.3718C>T, NM_000426.3:c.2750-1G>C, NM_000426.3:c.2049_2050delAG, NM_000426.3:c.5050G>T, NM_000426.3:c.1634T>A, NM_000426.3:c.2045_2046delAG, NM_000426.3:c.4645C>T, NM_000426.3:c.2962C>T, NM_000426.3:c.2098_2099delTT, NM_000426.3:c.4437-5T>A, NM_000426.3:c.2901C>A, NM_000426.3:c.112+1G>A, NM_000426.3:c.7732C>T, NM_000426.3:c.6038delT, NM_000426.3:c.7888C>T, NM_000426.3:c.825delC, NM_000426.3:c.8314delA, NM_000426.3:c.3976C>T, NM_000426.3:c.9101_9104dupAACA, NM_000426.3:c.9253C>T, NM_000426.3:c.2323-2A>T, NM_000426.3:c.8748delA, NM_000426.3:c.6334A>T, NM_000426.3:c.1050delT, NM_000426.3:c.7536delC, NM_000426.3:c.8705delT, NM_000426.3:c.9221delA, NM_000426.3:c.5227G>T, NM_000426.3:c.6429+1G>A, NM_000426.3:c.6617delT, NM_000426.3:c.2451-2A>G, NM_000426.3:c.6011delA, NM_000426.3:c.7810C>T, NM_000426.3:c.8684C>G, NM_000426.3:c.3630delT, NM_000426.3:c.3215delG, NM_000426.3:c.3623_3645delAGGGCATTGTTTTTCAACATCCA, NM_000426.3:c.6955C>T, NM_000426.3:c.7279_7280delCT, NM_000426.3:c.725G>A, NM_000426.3:c.7147C>T, NM_000426.3:c.3237C>A250,600
LAMA3Epidermolysis bullosa, junctionalNM_000227.3NM_000227.3:c.-122061G>T, NM_000227.3:c.335delG, NM_000227.3:c.4878dupT, NM_000227.3:c.2116A>T, NM_000227.3:c.4135C>T, NM_000227.3:c.751G>T, NM_000227.3:c.1981C>T, NM_000227.3:c.3350+2T>G, NM_000227.3:c.1182delG, NM_000227.3:c.4335_4336insA, NM_000227.3:c.2662C>T600
LAMB3Epidermolysis bullosa, junctionalNM_000228.2NM_000228.2:c.1587_1588delAG, NM_000228.2:c.124C>T, NM_000228.2:c.1438_1442delCCGTG, NM_000228.2:c.1830G>A, NM_000228.2:c.565-2A>G, NM_000228.2:c.2806C>T, NM_000228.2:c.904delT, NM_000228.2:c.1357delT, NM_000228.2:c.3228+1G>T, NM_000228.2:c.628+1delG, NM_000228.2:c.496C>T, NM_000228.2:c.1903C>T, NM_000228.2:c.628G>A, NM_000228.2:c.3228+1G>A, NM_000228.2:c.727C>T250,600
LAMC2Epidermolysis bullosa, junctionalNM_005562.2NM_005562.2:c.1659C>A, NM_005562.2:c.3069+1G>A, NM_005562.2:c.1782_1783delGC, NM_005562.2:c.2137_2143delCAGAACC, NM_005562.2:c.283C>T, NM_005562.2:c.343C>T, NM_005562.2:c.3512_3513insA, NM_005562.2:c.405-1G>A, NM_005562.2:c.3120_3121insA600
LARGEMuscular dystrophy-dystroglycanopathy type 6NM_004737.4NM_004737.4:c.1102C>T, NM_004737.4:c.992C>T, NM_004737.4:c.1525G>A, NM_004737.4:c.1483T>C600
LBRGreenberg skeletal dysplasiaNM_002296.3NM_002296.3:c.1748G>A, NM_002296.3:c.1402delT, NM_002296.3:c.1114C>T, NM_002296.3:c.32_35delTGGT600
LDHAGlycogen storage disease type 11NM_005566.3NM_005566.3:c.126+1_126+4delGTAA, NM_005566.3:c.126+1G>A, NM_005566.3:c.126+1_126+4del, NM_005566.3:c.213+1_213+4delGTAA, NM_005566.3:c.640_641delCT600
LEPRE1Osteogenesis imperfecta type 8NM_022356.3NM_022356.3:c.2055+13_2055+31del19, NM_022356.3:c.1656C>A, NM_022356.3:c.1365_1366delAGinsC, NM_022356.3:c.2068_2086delCGAGCGGGTGAGAGCAGCT, NM_022356.3:c.747delC, NM_022356.3:c.1102C>T, NM_022356.3:c.1473+1G>T600
LHFPL5Deafness type 67, autosomal recessiveNM_182548.3NM_182548.3:c.494C>T, NM_182548.3:c.476G>A, NM_182548.3:c.649delG, NM_182548.3:c.250delC, NM_182548.3:c.380A>G600
LHX3Combined pituitary hormone deficiency type 3NM_014564.3NM_014564.3:c.687G>A, NM_014564.3:c.347A>G600
LIFRStuve-Wiedemann syndromeNM_002310.5NM_002310.5:c.2013_2014insT, NM_002310.5:c.653dupT, NM_002310.5:c.1018_1022delAATTG, NM_002310.5:c.2503G>T, NM_002310.5:c.171_174delTAAC, NM_002310.5:c.1789C>T600
LIG4LIG4 syndromeNM_002312.3NM_002312.3:c.1271_1275delAAAGA, NM_002312.3:c.833G>A, NM_002312.3:c.1738C>T, NM_002312.3:c.2440C>T, NM_002312.3:c.1406G>A, NM_002312.3:c.1455_1456delTG, NM_002312.3:c.1369_1372delGGAC, NM_002312.3:c.1512_1513delTC600
LMNACardiomyopathy, dilated type 1ANM_170707.3NM_170707.3:c.1366A>C, NM_170707.3:c.1930C>T, NM_170707.3:c.1567G>A, NM_170707.3:c.1786G>A250,600
LMNAHutchinson-Gilford progeria syndromeNM_170707.3NM_170707.3:c.1579C>T, NM_170707.3:c.1411C>T, NM_170707.3:c.1824C>T, NM_170707.3:c.1626G>C250,600
LMNALipodystrophy, familial partial, type 2NM_170707.3NM_170707.3:c.1318G>A250,600
LMNAMandibuloacral dysplasiaNM_170707.3NM_170707.3:c.1586C>T, NM_170707.3:c.1580G>A, NM_170707.3:c.1585G>A, NM_170707.3:c.1228C>T250,600
LMNAMuscular dystrophy, Emery-Dreifuss type 3NM_170707.3NM_170707.3:c.1072G>A, NM_170707.3:c.419T>C, NM_170707.3:c.1488+1G>A, NM_170707.3:c.1583C>A250,600
LOXHD1Deafness type 77, autosomal recessiveNM_144612.6NM_144612.6:c.2008C>T, NM_144612.6:c.2T>A, NM_144612.6:c.3874C>T, NM_144612.6:c.4526G>A, NM_144612.6:c.3924C>A, NM_144612.6:c.512-1G>A, NM_144612.6:c.4524_4525delAG, NM_144612.6:c.4714C>T, NM_144612.6:c.457_461dupCGCCA600
LRATLeber congenital amaurosis type 14NM_004744.3NM_004744.3:c.217_218delAT, NM_004744.3:c.588dupT600
LRATRetinal dystrophy, early-onset severeNM_004744.3NM_004744.3:c.525T>A600
LRP2Donnai-Barrow syndromeNM_004525.2NM_004525.2:c.11469_11472delTTTG, NM_004525.2:c.2640-1G>A, NM_004525.2:c.13139_13140insC, NM_004525.2:c.1093C>T, NM_004525.2:c.11663G>A, NM_004525.2:c.7564T>C, NM_004525.2:c.8519_8522delATTT, NM_004525.2:c.1341+2T>G, NM_004525.2:c.10769-2A>G, NM_004525.2:c.9484_9485delGT, NM_004525.2:c.13388+2T>C, NM_004525.2:c.11636-1G>T600
LRP5Exudative vitreoretinopathy type 4NM_002335.3NM_002335.3:c.2254C>G, NM_002335.3:c.518C>T, NM_002335.3:c.1709G>A, NM_002335.3:c.804_813delGGGGAAGAGG, NM_002335.3:c.4099G>A250,600
LRP5Isolated polycystic liver diseaseNM_002335.3NM_002335.3:c.4651G>A250,600
LRP5Osteoporosis-pseudoglioma syndromeNM_002335.3NM_002335.3:c.1481G>A, NM_002335.3:c.1453G>T, NM_002335.3:c.1468delG, NM_002335.3:c.2305delG, NM_002335.3:c.2202G>A, NM_002335.3:c.1708C>T, NM_002335.3:c.3107G>A, NM_002335.3:c.2557C>T250,600
LRPPRCLeigh syndrome, French-Canadian typeNM_133259.3NM_133259.3:c.1061C>T, NM_133259.3:c.3830_3839delGTGGTGCAATinsAG600
LRTOMTDeafness type 63, utosomal recessiveNM_001145308.4NM_001145308.4:c.242G>A600
MAKRetinitis pigmentosa type 62NM_001242957.1NM_001242957.1:c.37G>A, NM_001242957.1:c.719_720dupAG, NM_001242957.1:c.1087_1088delAG, NM_001242957.1:c.718C>T, NM_001242957.1:c.388A>C600
MAN2B1Alpha-mannosidosisNM_000528.3NM_000528.3:c.215A>T, NM_000528.3:c.2401G>T, NM_000528.3:c.2278C>T, NM_000528.3:c.2368C>T, NM_000528.3:c.2119C>T, NM_000528.3:c.2013delT, NM_000528.3:c.1A>G, NM_000528.3:c.1067C>G, NM_000528.3:c.384G>A, NM_000528.3:c.2398G>A, NM_000528.3:c.1915C>T, NM_000528.3:c.2426T>C, NM_000528.3:c.2436+2T>C, NM_000528.3:c.1259G>T, NM_000528.3:c.1780C>T, NM_000528.3:c.1929G>A, NM_000528.3:c.2686_2687delCTinsG, NM_000528.3:c.1830+1G>C250,600
MARVELD2Deafness type 49, autosomal recessiveNM_001038603.2NM_001038603.2:c.1363C>T, NM_001038603.2:c.1183-1G>A600
MAT1AMethionine adenosyltransferase deficiencyNM_000429.2NM_000429.2:c.1006G>A, NM_000429.2:c.1070C>T, NM_000429.2:c.595C>T, NM_000429.2:c.1043_1044delTG, NM_000429.2:c.790C>T, NM_000429.2:c.827_828insG, NM_000429.2:c.538_539insTG, NM_000429.2:c.914T>C, NM_000429.2:c.791G>A, NM_000429.2:c.966T>G600
MATN3Multiple epiphyseal dysplasia type 5NM_002381.4NM_002381.4:c.1405+2T>C, NM_002381.4:c.910T>A, NM_002381.4:c.1303G>A, NM_002381.4:c.693G>C600
MBTPS2Ichthyosis follicularis-atrichia-photophobiaNM_015884.3NM_015884.3:c.1286G>A, NM_015884.3:c.1424T>C, NM_015884.3:c.677G>T, NM_015884.3:c.261G>A600
MCCC13-Methylcrotonyl-CoA carboxylase type 1 deficiencyNM_020166.4NM_020166.4:c.1155A>C, NM_020166.4:c.1930G>T, NM_020166.4:c.2079delA, NM_020166.4:c.388G>A, NM_020166.4:c.559T>C, NM_020166.4:c.343C>T, NM_020166.4:c.640-2A>G, NM_020166.4:c.1942G>A, NM_020166.4:c.1905delA, NM_020166.4:c.640-1G>A, NM_020166.4:c.1074delG, NM_020166.4:c.1114C>T, NM_020166.4:c.558delA, NM_020166.4:c.1277T>C, NM_020166.4:c.1526delG, NM_020166.4:c.1380T>G, NM_020166.4:c.310C>T, NM_020166.4:c.1310T>C600
MCCC23-Methylcrotonyl-CoA carboxylase 2 deficiency, type 2NM_022132.4NM_022132.4:c.295G>C, NM_022132.4:c.380C>G, NM_022132.4:c.1309A>G, NM_022132.4:c.515_516insT, NM_022132.4:c.1015G>A, NM_022132.4:c.464G>A, NM_022132.4:c.641delG, NM_022132.4:c.1576_1577insT, NM_022132.4:c.735_736insC, NM_022132.4:c.517_518insT, NM_022132.4:c.838G>T, NM_022132.4:c.499T>C, NM_022132.4:c.1367C>T, NM_022132.4:c.929C>G, NM_022132.4:c.1065A>T, NM_022132.4:c.1580G>A, NM_022132.4:c.994C>T, NM_022132.4:c.1072+1G>A250,600
MCEEMethylmalonic acidemia due to methylmalonyl-CoA epimerase deficiencyNM_032601.3NM_032601.3:c.178A>C, NM_032601.3:c.2T>C, NM_032601.3:c.139C>T600
MCOLN1Mucolipidosis type 4NM_020533.2NM_020533.2:c.1084G>T, NM_020533.2:c.304C>T, NM_020533.2:c.1207C>T, NM_020533.2:c.964C>T600
MCPH1Microcephaly, primary, type 1, autosomal recessiveNM_024596.3NM_024596.3:c.1973+1G>A, NM_024596.3:c.2221C>T, NM_024596.3:c.427_428insA, NM_024596.3:c.1561G>T, NM_024596.3:c.1935+1G>T, NM_024596.3:c.215C>T, NM_024596.3:c.1249_1250insT600
MECP2Rett syndromeNM_004992.3NM_004992.3:c.1048_1050delAGC, NM_004992.3:c.215dupC, NM_004992.3:c.611C>G, NM_004992.3:c.1282G>A, NM_004992.3:c.916C>T, NM_004992.3:c.806delG, NM_004992.3:c.502C>T, NM_004992.3:c.880C>T, NM_004992.3:c.674C>T, NM_004992.3:c.964C>T, NM_004992.3:c.705G>A, NM_004992.3:c.808C>T, NM_004992.3:c.730C>T, NM_004992.3:c.683C>G, NM_004992.3:c.753delC, NM_004992.3:c.965C>T, NM_004992.3:c.763C>T600
MED12Ohdo syndromeNM_005120.2NM_005120.2:c.3493T>C, NM_005120.2:c.5185C>A, NM_005120.2:c.3443G>A600
MED25Charcot-Marie-Tooth disease type 2B2NM_030973.3NM_030973.3:c.316delG, NM_030973.3:c.1366C>T, NM_030973.3:c.1004C>T250,600
MEFVFamilial mediterranean feverNM_000243.2NM_000243.2:c.163_164insA, NM_000243.2:c.1437C>G, NM_000243.2:c.2282G>A, NM_000243.2:c.163dupA, NM_000243.2:c.2076_2078delAAT, NM_000243.2:c.1958G>A, NM_000243.2:c.443A>T, NM_000243.2:c.656_657insG, NM_000243.2:c.688G>A, NM_000243.2:c.800C>T, NM_000243.2:c.1223G>A, NM_000243.2:c.501G>C, NM_000243.2:c.2040G>A, NM_000243.2:c.2040G>C, NM_000243.2:c.2084A>G, NM_000243.2:c.1141C>T, NM_000243.2:c.1016C>T, NM_000243.2:c.2177T>C, NM_000243.2:c.1772T>C, NM_000243.2:c.2080A>G, NM_000243.2:c.2082G>A, NM_000243.2:c.2230G>T250,600
MERTKRetinitis pigmentosa type 38NM_006343.2NM_006343.2:c.2189+1G>T, NM_006343.2:c.1605-2A>G, NM_006343.2:c.2070_2074delAGGAC, NM_006343.2:c.2784_2785insTA, NM_006343.2:c.2785_2786dupTA, NM_006343.2:c.2323C>T, NM_006343.2:c.2207_2210delCTGT250,600
MFRPMicrophthalmia - Retinitis pigmentosa - foveoschisis - optic disc drusenNM_031433.3NM_031433.3:c.498delC, NM_031433.3:c.523C>T, NM_031433.3:c.629G>T, NM_031433.3:c.1150_1151insC, NM_031433.3:c.545T>C, NM_031433.3:c.1124+1G>T250,600
MFSD8Ceroid lipofuscinosis, neuronal, type 7NM_152778.2NM_152778.2:c.1286G>A, NM_152778.2:c.999-2A>G, NM_152778.2:c.1235C>T, NM_152778.2:c.1090delA, NM_152778.2:c.362A>G, NM_152778.2:c.881C>A, NM_152778.2:c.929G>A, NM_152778.2:c.1525_1526delCT, NM_152778.2:c.894T>G600
MGAT2Congenital disorders of glycosylation 2a typeNM_002408.3NM_002408.3:c.869C>T, NM_002408.3:c.785A>G, NM_002408.3:c.1017T>A600
MKKSBardet-Biedl/McKusick-Kaufman syndromeNM_018848.3NM_018848.3:c.353delG250,600
MKKSBardet-Biedl syndrome type 6NM_018848.3NM_018848.3:c.830T>C, NM_018848.3:c.1436C>G250,600
MKKSMcKusick-Kaufman syndromeNM_018848.3NM_018848.3:c.250C>T, NM_018848.3:c.1225_1226delGG, NM_018848.3:c.724G>T250,600
MKS1Bardet-Biedl syndrome type 13NM_017777.3NM_017777.3:c.1349T>C250,600
MKS1Meckel type 1/Bardet-Biedl syndromeNM_017777.3NM_017777.3:c.1024+1G>A, NM_017777.3:c.857A>G, NM_017777.3:c.1319T>C, NM_017777.3:c.814G>C, NM_017777.3:c.508C>T, NM_017777.3:c.1319G>C250,600
MLC1Megalencephalic leukoencephalopathy with subcortical cysts 1NM_015166.3NM_015166.3:c.135_136insC, NM_015166.3:c.206C>T, NM_015166.3:c.278C>T, NM_015166.3:c.424-2A>C, NM_015166.3:c.422A>G, NM_015166.3:c.274C>T, NM_015166.3:c.839C>T, NM_015166.3:c.423C>A, NM_015166.3:c.33_34insC600
MLYCDMalonyl-CoA decarboxylase deficiencyNM_012213.2NM_012213.2:c.758delT, NM_012213.2:c.679delinsATGAAGC, NM_012213.2:c.560C>G600
MMAAVitamin B12-responsive methylmalonic acidemia type cblANM_172250.2NM_172250.2:c.1034delT, NM_172250.2:c.283C>T, NM_172250.2:c.440G>A, NM_172250.2:c.451delC, NM_172250.2:c.592_595delCTGA, NM_172250.2:c.503delC, NM_172250.2:c.450_451insG, NM_172250.2:c.811G>T, NM_172250.2:c.586C>T, NM_172250.2:c.387C>A, NM_172250.2:c.620A>G600
MMABVitamin B12-responsive methylmalonic acidemia type cblBNM_052845.3NM_052845.3:c.557G>A, NM_052845.3:c.556C>T, NM_052845.3:c.569G>A, NM_052845.3:c.568C>T, NM_052845.3:c.577G>A, NM_052845.3:c.197-1G>T, NM_052845.3:c.700C>T, NM_052845.3:c.548A>T, NM_052845.3:c.220G>T, NM_052845.3:c.197-1G>A600
MMACHCMethylmalonic aciduria cblC type, with homocystinuriaNM_015506.2NM_015506.2:c.389A>G, NM_015506.2:c.388T>C, NM_015506.2:c.482G>A, NM_015506.2:c.609G>A, NM_015506.2:c.688C>T, NM_015506.2:c.394C>T, NM_015506.2:c.440G>C, NM_015506.2:c.608G>A, NM_015506.2:c.481C>T, NM_015506.2:c.619_620insG, NM_015506.2:c.547_548delGT, NM_015506.2:c.347T>C, NM_015506.2:c.658_660delAAG, NM_015506.2:c.388_390delTAC, NM_015506.2:c.615C>A, NM_015506.2:c.331C>T, NM_015506.2:c.616C>T, NM_015506.2:c.270_271insA, NM_015506.2:c.271dupA, NM_015506.2:c.615C>G250,600
MMADHCmethylmalonic aciduria cblD type, with homocystinuriaNM_015702.2NM_015702.2:c.545C>A, NM_015702.2:c.746A>G, NM_015702.2:c.419dupA, NM_015702.2:c.748C>T, NM_015702.2:c.795_796insT, NM_015702.2:c.57_64delCTCTTTAG, NM_015702.2:c.737A>G, NM_015702.2:c.776T>C, NM_015702.2:c.478+1G>T600
MOCS1Molybdenum cofactor deficiency type ANM_005943.5NM_005943.5:c.218G>A, NM_005943.5:c.397_406delCCGGACGTGG, NM_005943.5:c.217C>T, NM_005943.5:c.956G>A, NM_005943.5:c.1027C>T600
MOCS2Molybdenum cofactor deficiency type BNM_176806.3NM_176806.3:c.106_107delAT, NM_176806.3:c.*297+1G>A, NM_176806.3:c.58delT, NM_176806.3:c.245delT, NM_176806.3:c.190G>A, NM_176806.3:c.16C>T, NM_176806.3:c.*487A>C, NM_176806.3:c.*422G>A, NM_176806.3:c.*26_*27delAT, NM_176806.3:c.539_540delAA, NM_176806.3:c.*459_*460delAA250,600
MPICongenital disorders of glycosylation type 1bNM_002435.2NM_002435.2:c.305C>T, NM_002435.2:c.656G>A, NM_002435.2:c.982C>T, NM_002435.2:c.413T>C, NM_002435.2:c.884G>A, NM_002435.2:c.1016_1019delACCC600
MPV17Mitochondrial DNA depletion syndrome type 6NM_002437.4NM_002437.4:c.263_265delAGA, NM_002437.4:c.148C>T, NM_002437.4:c.149G>A, NM_002437.4:c.263A>T, NM_002437.4:c.284_285insG, NM_002437.4:c.498C>A, NM_002437.4:c.462-2A>C, NM_002437.4:c.70G>T, NM_002437.4:c.359G>A600
MPZDejerine-Sottas syndrome (MPZ)NM_000530.6NM_000530.6:c.661G>A, NM_000530.6:c.380G>A, NM_000530.6:c.123_125delTGT, NM_000530.6:c.407T>A, NM_000530.6:c.560_563dupAGGC, NM_000530.6:c.355_356insTCTACT, NM_000530.6:c.661_662dupGC, NM_000530.6:c.411C>T, NM_000530.6:c.188C>G, NM_000530.6:c.506delT, NM_000530.6:c.190_192delTTC, NM_000530.6:c.496_499delCTCGinsTCC, NM_000530.6:c.372_377delGTTCAC, NM_000530.6:c.89T>C, NM_000530.6:c.499G>C, NM_000530.6:c.368G>A600
MPZNeuropathy, congenital hypomyelinating or amyelinatingNM_000530.6NM_000530.6:c.588dupT, NM_000530.6:c.626_630delCGTCG, NM_000530.6:c.392A>G, NM_000530.6:c.578G>A, NM_000530.6:c.397C>T, NM_000530.6:c.164G>T, NM_000530.6:c.150C>G, NM_000530.6:c.142C>G, NM_000530.6:c.130_137delTCCCGGGT, NM_000530.6:c.128G>T, NM_000530.6:c.549dupG, NM_000530.6:c.106A>G, NM_000530.6:c.410G>C, NM_000530.6:c.332C>T, NM_000530.6:c.371C>A, NM_000530.6:c.368_382delGCACGTTCACTTGTG, NM_000530.6:c.382G>A, NM_000530.6:c.393C>A, NM_000530.6:c.103G>T, NM_000530.6:c.88A>T, NM_000530.6:c.106A>T, NM_000530.6:c.419C>G600
MRPS16Combined oxidative phosphorylation deficiency type 2NM_016065.3NM_016065.3:c.2T>C, NM_016065.3:c.331C>T600
MRPS22Combined oxidative phosphorylation deficiency type 5NM_020191.2NM_020191.2:c.509G>A, NM_020191.2:c.644T>C, NM_020191.2:c.40_41insA600
MTHFRHomocystinuria due to MTHFR deficiencyNM_005957.4NM_005957.4:c.1743G>A, NM_005957.4:c.3G>A, NM_005957.4:c.547C>T, NM_005957.4:c.1129C>T, NM_005957.4:c.1768delC, NM_005957.4:c.968T>C, NM_005957.4:c.971A>G, NM_005957.4:c.439C>T600
MTM1Myotubular myopathy, X-linkedNM_000252.2NM_000252.2:c.1415_1416delGT, NM_000252.2:c.1357_1358delCC, NM_000252.2:c.461T>G, NM_000252.2:c.420C>G, NM_000252.2:c.595_599delCCTGC, NM_000252.2:c.1261-10A>G, NM_000252.2:c.780T>A, NM_000252.2:c.670C>T, NM_000252.2:c.1306_1310dupCCTAT, NM_000252.2:c.969delA, NM_000252.2:c.721C>T, NM_000252.2:c.70C>T, NM_000252.2:c.969dupA600
MTMR2Charcot-Marie-Tooth disease type 4B1NM_016156.5NM_016156.5:c.88C>T, NM_016156.5:c.304C>T, NM_016156.5:c.1276C>T, NM_016156.5:c.88A>T600
MTTPAbetalipoproteinemiaNM_000253.3NM_000253.3:c.1769G>T, NM_000253.3:c.2030delC, NM_000253.3:c.1619G>A, NM_000253.3:c.2593G>T, NM_000253.3:c.708_709delCA, NM_000253.3:c.1867+1G>A, NM_000253.3:c.703_704delAC250,600
MUTMethylmalonic acidemiaNM_000255.3NM_000255.3:c.1420C>T, NM_000255.3:c.1445-2A>G, NM_000255.3:c.2080C>T, NM_000255.3:c.1867G>A, NM_000255.3:c.607G>A, NM_000255.3:c.1658delT, NM_000255.3:c.1280G>A, NM_000255.3:c.1399C>T, NM_000255.3:c.914T>C, NM_000255.3:c.643G>A, NM_000255.3:c.655A>T, NM_000255.3:c.1741C>T, NM_000255.3:c.1106G>A, NM_000255.3:c.1871A>G, NM_000255.3:c.1924G>C, NM_000255.3:c.682C>T, NM_000255.3:c.572C>A, NM_000255.3:c.313T>C, NM_000255.3:c.1181T>A, NM_000255.3:c.278G>A, NM_000255.3:c.678_679insAATTTATG, NM_000255.3:c.794dupT, NM_000255.3:c.671_678dupAATTTATG, NM_000255.3:c.2150G>T, NM_000255.3:c.280G>A, NM_000255.3:c.91C>T, NM_000255.3:c.1207C>T250,600
MVKHyper-IgD syndromeNM_000431.3NM_000431.3:c.829C>T, NM_000431.3:c.803T>C, NM_000431.3:c.185G>A, NM_000431.3:c.494C>T, NM_000431.3:c.59A>C, NM_000431.3:c.1129G>A250,600
MVKMevalonic aciduriaNM_000431.3NM_000431.3:c.1000G>A, NM_000431.3:c.902A>C, NM_000431.3:c.928G>A250,600
MYO15ADeafness type 3, autosomal recessiveNM_016239.3NM_016239.3:c.3385C>T, NM_016239.3:c.6003delG, NM_016239.3:c.6004delG, NM_016239.3:c.10573delA, NM_016239.3:c.3313G>T, NM_016239.3:c.3336delG, NM_016239.3:c.755dupA, NM_016239.3:c.5492G>T, NM_016239.3:c.4351G>A, NM_016239.3:c.6864_6874delGGACCTGGAGC, NM_016239.3:c.4751_4752dupTC, NM_016239.3:c.625G>T, NM_016239.3:c.3693-2A>G, NM_016239.3:c.6614C>T, NM_016239.3:c.6743C>T, NM_016239.3:c.6046+2T>G, NM_016239.3:c.5326C>T, NM_016239.3:c.3756+1G>T, NM_016239.3:c.8410A>T, NM_016239.3:c.8429_8447delGCGGGCAGCTGCGGGTCCT, NM_016239.3:c.8148G>T, NM_016239.3:c.9958_9961delGACT, NM_016239.3:c.4750_4751insTC, NM_016239.3:c.8548C>T250,600
MYO3ADeafness type 30, autosomal recessiveNM_017433.4NM_017433.4:c.1086T>G, NM_017433.4:c.2793+2T>A, NM_017433.4:c.4586+2T>G, NM_017433.4:c.4730+1G>A, NM_017433.4:c.1A>G, NM_017433.4:c.2506-1G>A, NM_017433.4:c.1777-12G>A, NM_017433.4:c.1952delC, NM_017433.4:c.1193C>A, NM_017433.4:c.770C>G, NM_017433.4:c.3154C>T, NM_017433.4:c.585+5G>C, NM_017433.4:c.2243delA, NM_017433.4:c.3112-2A>G, NM_017433.4:c.732-2A>G250,600
MYO5AGriscelli syndrome type 1NM_000259.3NM_000259.3:c.1145delC, NM_000259.3:c.2332C>T600
MYO6Deafness type 37, autosomal recessiveNM_004999.3NM_004999.3:c.2897_2899delAAG, NM_004999.3:c.2840G>A, NM_004999.3:c.647A>T, NM_004999.3:c.3496C>T, NM_004999.3:c.3808C>T, NM_004999.3:c.1446_1447insT250,600
MYO7ADeafness type 2, autosomal recessiveNM_000260.3NM_000260.3:c.1797G>A, NM_000260.3:c.2023C>T, NM_000260.3:c.731G>C, NM_000260.3:c.3596dupT, NM_000260.3:c.1184G>A, NM_000260.3:c.133-2A>G250,600
MYO7AUsher syndrome type 1BNM_000260.3NM_000260.3:c.1996C>T, NM_000260.3:c.1884C>A, NM_000260.3:c.448C>T, NM_000260.3:c.2476G>A, NM_000260.3:c.4024delT, NM_000260.3:c.2617C>T, NM_000260.3:c.5227C>T, NM_000260.3:c.1344-1G>A, NM_000260.3:c.5507T>G, NM_000260.3:c.5886_5889delCTTT, NM_000260.3:c.3504-1G>C, NM_000260.3:c.3508G>A, NM_000260.3:c.4018G>A, NM_000260.3:c.5392C>T, NM_000260.3:c.640G>A, NM_000260.3:c.3134T>C, NM_000260.3:c.5824G>T, NM_000260.3:c.3G>A, NM_000260.3:c.494C>T, NM_000260.3:c.5618G>A, NM_000260.3:c.5884_5887delTTCT, NM_000260.3:c.634C>T, NM_000260.3:c.3719G>A, NM_000260.3:c.5967C>G, NM_000260.3:c.3763delA, NM_000260.3:c.635G>A, NM_000260.3:c.6025delG250,600
NAGASchindler diseaseNM_000262.2NM_000262.2:c.973G>A, NM_000262.2:c.985C>T, NM_000262.2:c.986G>A, NM_000262.2:c.577G>T250,600
NAGSHyperammonemia due to N-acetylglutamate synthetase deficiencyNM_153006.2NM_153006.2:c.971G>A, NM_153006.2:c.1289T>C, NM_153006.2:c.1025delG, NM_153006.2:c.916-2A>T, NM_153006.2:c.1307dupT, NM_153006.2:c.1299G>C600
NDRG1Charcot-Marie-Tooth disease, type 4DNM_006096.3NM_006096.3:c.16C>T, NM_006096.3:c.-18-2_-18-1delAG, NM_006096.3:c.538-1G>A, NM_006096.3:c.-18-2_-18-1del1, NM_006096.3:c.928C>T, NM_006096.3:c.442C>T600
NEBNemaline myopathy type 2NM_004543.4NM_004543.4:c.11474_11475delTG, NM_004543.4:c.19119_19120delGA, NM_004543.4:c.19306-1G>A, NM_004543.4:c.19606G>T, NM_004543.4:c.6105dupT, NM_004543.4:c.3191A>G, NM_004543.4:c.18318_18319delAG, NM_004543.4:c.11473_11474delAT, NM_004543.4:c.2173G>T, NM_004543.4:c.19097_19098delTT, NM_004543.4:c.19836+1_19836+2insATGGA, NM_004543.4:c.18825+1370C>T, NM_004543.4:c.5567G>A, NM_004543.4:c.6105_6106insT, NM_004543.4:c.16842+1G>A, NM_004543.4:c.843T>G, NM_004543.4:c.8031_8041delAAATAAACGAG, NM_004543.4:c.14182_14183delGCinsAA, NM_004543.4:c.15973C>T250,600
NEFLCharcot-Marie-Tooth disease type 1FNM_006158.3NM_006158.3:c.418G>T, NM_006158.3:c.628G>T, NM_006158.3:c.361G>T600
NEUROG3Diarrhea type 4, malabsorptive, congenitalNM_020999.3NM_020999.3:c.319C>A, NM_020999.3:c.278G>T600
NHP2Dyskeratosis congenita type 2, autosomal recessiveNM_017838.3NM_017838.3:c.415T>C, NM_017838.3:c.460T>A, NM_017838.3:c.289_290delAT600
NMNAT1Leber congenital amaurosis type 9NM_022787.3NM_022787.3:c.451G>T, NM_022787.3:c.25G>A, NM_022787.3:c.457C>G, NM_022787.3:c.507G>A, NM_022787.3:c.710G>T, NM_022787.3:c.619C>T, NM_022787.3:c.769G>A250,600
NOP10Dyskeratosis congenita type 1, autosomal recessiveNM_018648.3NM_018648.3:c.34G>C, NM_018648.3:c.100C>T600
NPC1Niemann-Pick disease type C1NM_000271.4NM_000271.4:c.1042C>T, NM_000271.4:c.2842G>A, NM_000271.4:c.1628C>T, NM_000271.4:c.2974G>T, NM_000271.4:c.3019C>G, NM_000271.4:c.1211G>A, NM_000271.4:c.2072C>T, NM_000271.4:c.2324A>C, NM_000271.4:c.337T>C, NM_000271.4:c.3107C>T, NM_000271.4:c.530G>A, NM_000271.4:c.743G>T, NM_000271.4:c.3611_3614delTTAC, NM_000271.4:c.813_815delCAT, NM_000271.4:c.2932C>T, NM_000271.4:c.3425T>C, NM_000271.4:c.2761C>T, NM_000271.4:c.3104C>T, NM_000271.4:c.3662delT, NM_000271.4:c.2972_2973delAG, NM_000271.4:c.2974G>A, NM_000271.4:c.2873G>A, NM_000271.4:c.352_353delAG, NM_000271.4:c.3182T>C, NM_000271.4:c.3467A>G, NM_000271.4:c.3175C>T, NM_000271.4:c.2861C>T, NM_000271.4:c.2848G>A250,600
NPC2Niemann-Pick disease type C2NM_006432.3NM_006432.3:c.115G>A, NM_006432.3:c.190+5G>A, NM_006432.3:c.27delG, NM_006432.3:c.352G>T, NM_006432.3:c.58G>T, NM_006432.3:c.358C>T, NM_006432.3:c.295T>C, NM_006432.3:c.441+1G>A, NM_006432.3:c.436C>T250,600
NPHP1Nephronophthisis type 1NM_000272.3NM_000272.3:c.80T>A, NM_000272.3:c.1delA, NM_000272.3:c.555_556insA, NM_000272.3:c.829C>T, NM_000272.3:c.455C>G, NM_000272.3:c.1884+1G>T, NM_000272.3:c.1184dupC600
NPHP3Nephronophthisis type 3NM_153240.4NM_153240.4:c.1817G>A, NM_153240.4:c.434_437delAAAG, NM_153240.4:c.1119-2A>G, NM_153240.4:c.1729C>T, NM_153240.4:c.2694-2A>G, NM_153240.4:c.1985+5G>A, NM_153240.4:c.3406C>T, NM_153240.4:c.3373C>T, NM_153240.4:c.1381G>T, NM_153240.4:c.2694-2_2694-1delAG, NM_153240.4:c.1157A>G, NM_153240.4:c.2369T>C, NM_153240.4:c.3550G>A, NM_153240.4:c.2541delG, NM_153240.4:c.2570+1G>T, NM_153240.4:c.3156_3157insA, NM_153240.4:c.3662C>T250,600
NPHP4Nephronophthisis type 4NM_015102.4NM_015102.4:c.4179T>A, NM_015102.4:c.3767_3768insAA, NM_015102.4:c.3674C>T, NM_015102.4:c.556_557insT, NM_015102.4:c.2940_2944dupGCTCC, NM_015102.4:c.3231+1G>C, NM_015102.4:c.517C>T, NM_015102.4:c.2335C>T, NM_015102.4:c.2219G>A, NM_015102.4:c.7G>T, NM_015102.4:c.1972C>T, NM_015102.4:c.1120-1G>C250,600
NPHS1Nephrotic syndrome type 1NM_004646.3NM_004646.3:c.59-5C>G, NM_004646.3:c.3109+1G>A, NM_004646.3:c.3478C>T, NM_004646.3:c.121_122delCT, NM_004646.3:c.1481delC, NM_004646.3:c.2456A>T, NM_004646.3:c.2491C>T, NM_004646.3:c.2464G>A, NM_004646.3:c.1307_1308dupAC, NM_004646.3:c.3250delG, NM_004646.3:c.3325C>T, NM_004646.3:c.2928G>T, NM_004646.3:c.3250_3251insG, NM_004646.3:c.2746G>T, NM_004646.3:c.1715G>A250,600
NR0B1Cytomegalic congenital adrenal hypoplasiaNM_000475.4NM_000475.4:c.513G>A, NM_000475.4:c.591C>A, NM_000475.4:c.315G>C, NM_000475.4:c.873G>C, NM_000475.4:c.800G>C, NM_000475.4:c.788T>A, NM_000475.4:c.704G>A, NM_000475.4:c.1319A>T, NM_000475.4:c.388_389delTA, NM_000475.4:c.273C>A, NM_000475.4:c.813C>G, NM_000475.4:c.847C>T, NM_000475.4:c.1107G>A, NM_000475.4:c.890T>C, NM_000475.4:c.1316T>G600
NR2E3Enhaced S-Cone SyndromeNM_014249.3NM_014249.3:c.119-2A>C, NM_014249.3:c.297_298delGT, NM_014249.3:c.932G>A, NM_014249.3:c.226C>T, NM_014249.3:c.361G>A, NM_014249.3:c.227G>A, NM_014249.3:c.1034_1038delTGCAG250,600
NTRK1Hereditary sensory and autonomic neuropathy type 4NM_001012331.1NM_001012331.1:c.1076A>G, NM_001012331.1:c.1711G>C, NM_001012331.1:c.1741A>G, NM_001012331.1:c.1908_1909insT, NM_001012331.1:c.1709delT, NM_001012331.1:c.1942C>T, NM_001012331.1:c.1852C>T, NM_001012331.1:c.1456G>A, NM_001012331.1:c.2321G>C, NM_001012331.1:c.2066C>T600
NUP62Infantile striatal degenerationNM_153719.3NM_153719.3:c.1172A>C600
NYXNight blindness, congenital stationary , type 1A, X-linkedNM_022567.2NM_022567.2:c.1049G>A600
OATGyrate atrophy of choroid and retina with or without ornithinemiaNM_000274.3NM_000274.3:c.1250C>T, NM_000274.3:c.159delC, NM_000274.3:c.1205T>C, NM_000274.3:c.901-2A>G, NM_000274.3:c.533G>A, NM_000274.3:c.1276C>T, NM_000274.3:c.824G>A, NM_000274.3:c.268C>G, NM_000274.3:c.952delG, NM_000274.3:c.994G>A, NM_000274.3:c.955C>T, NM_000274.3:c.677C>T, NM_000274.3:c.278G>T, NM_000274.3:c.627T>A, NM_000274.3:c.812G>A, NM_000274.3:c.952G>A, NM_000274.3:c.539G>C, NM_000274.3:c.596C>A600
OCA2Oculocutaneous albinism type 2NM_000275.2NM_000275.2:c.1610A>G, NM_000275.2:c.1960delG, NM_000275.2:c.2359G>A, NM_000275.2:c.819_822delCTGGinsGGTC, NM_000275.2:c.2228C>T, NM_000275.2:c.1025A>G, NM_000275.2:c.1842+1G>T, NM_000275.2:c.157delA, NM_000275.2:c.1182G>A, NM_000275.2:c.1182+2T>C, NM_000275.2:c.1441G>A, NM_000275.2:c.79G>A, NM_000275.2:c.1465A>G, NM_000275.2:c.1327G>A, NM_000275.2:c.1364+1G>T250,600
OCRLLowe syndromeNM_000276.3NM_000276.3:c.2299C>T, NM_000276.3:c.909_910delAG, NM_000276.3:c.2535delA, NM_000276.3:c.2403dupA, NM_000276.3:c.1499G>A, NM_000276.3:c.2530C>T600
OFD1Joubert syndrome type 10NM_003611.2NM_003611.2:c.2582dupT, NM_003611.2:c.2321_2322insT, NM_003611.2:c.277G>T600
OFD1Orofaciodigital syndrome type 1NM_003611.2NM_003611.2:c.43_44delAG, NM_003611.2:c.52G>T, NM_003611.2:c.65dupA, NM_003611.2:c.221C>T, NM_003611.2:c.274T>C, NM_003611.2:c.616_617delGA, NM_003611.2:c.260A>G, NM_003611.2:c.13-10T>A, NM_003611.2:c.312+1delG, NM_003611.2:c.224A>C, NM_003611.2:c.294_312delTGGTTTGGCAAAAGAAAAG, NM_003611.2:c.62_63insT, NM_003611.2:c.275_276delCT, NM_003611.2:c.614_617delGAGA, NM_003611.2:c.225C>G, NM_003611.2:c.602delA, NM_003611.2:c.628C>T, NM_003611.2:c.653delA, NM_003611.2:c.1365_1368delACAA, NM_003611.2:c.619_624delATAGAA, NM_003611.2:c.1303A>C, NM_003611.2:c.1318delC, NM_003611.2:c.654+2_654+3delTA, NM_003611.2:c.1268_1272delAAAAC, NM_003611.2:c.1323_1326delAGAA, NM_003611.2:c.1360_1363delCTTA, NM_003611.2:c.1358T>A, NM_003611.2:c.1840delG, NM_003611.2:c.1612C>T, NM_003611.2:c.1757delG, NM_003611.2:c.1821delG, NM_003611.2:c.1319delT, NM_003611.2:c.1859_1860delCCinsG, NM_003611.2:c.2261-1G>T, NM_003611.2:c.235G>A, NM_003611.2:c.607_610delTATA, NM_003611.2:c.594_598delAAAGC, NM_003611.2:c.247C>T, NM_003611.2:c.2387+1G>C, NM_003611.2:c.290A>G, NM_003611.2:c.454C>T, NM_003611.2:c.312+2_312+7delTAAAGT, NM_003611.2:c.413-10T>G, NM_003611.2:c.2349delC, NM_003611.2:c.518-1G>A, NM_003611.2:c.1322_1326delAAGAA, NM_003611.2:c.541dupG, NM_003611.2:c.243C>G, NM_003611.2:c.241C>G600
OPA33-methylglutaconic aciduria type 3NM_025136.3NM_025136.3:c.*24136delG, NM_025136.3:c.221delG600
OSTM1Osteopetrosis type 5, autosomal recessiveNM_014028.3NM_014028.3:c.415_416delAG600
OTCOrnithine transcarbamylase deficiencyNM_000531.5NM_000531.5:c.119G>A, NM_000531.5:c.259G>A, NM_000531.5:c.118C>T, NM_000531.5:c.617T>G, NM_000531.5:c.646C>G, NM_000531.5:c.148G>T, NM_000531.5:c.589G>T, NM_000531.5:c.77G>A, NM_000531.5:c.829C>T, NM_000531.5:c.674C>T, NM_000531.5:c.717+2T>C, NM_000531.5:c.563G>T, NM_000531.5:c.275G>A, NM_000531.5:c.245T>G, NM_000531.5:c.460G>T, NM_000531.5:c.134T>C, NM_000531.5:c.332T>C, NM_000531.5:c.238A>G, NM_000531.5:c.421C>T600
OTOADeafness type 22, autosomal recessiveNM_144672.3NM_144672.3:c.2301+1G>T, NM_144672.3:c.2359G>T, NM_144672.3:c.121-1G>A, NM_144672.3:c.827delT, NM_144672.3:c.1725_1726delCA250,600
OTOFDeaffness type 9, autosomal recessiveNM_194248.2NM_194248.2:c.149G>A, NM_194248.2:c.1867G>A, NM_194248.2:c.1669G>A, NM_194248.2:c.2381G>A, NM_194248.2:c.1498C>T, NM_194248.2:c.1544T>C, NM_194248.2:c.5473C>G, NM_194248.2:c.1150G>A, NM_194248.2:c.1778delT, NM_194248.2:c.5103+2T>A, NM_194248.2:c.227+2T>C, NM_194248.2:c.5474_5475delCC, NM_194248.2:c.5332G>A, NM_194248.2:c.584-1G>C, NM_194248.2:c.98G>A, NM_194248.2:c.2348delG, NM_194248.2:c.3032T>C, NM_194248.2:c.4559G>A, NM_194248.2:c.4491T>A, NM_194248.2:c.5816G>A, NM_194248.2:c.766-2A>G, NM_194248.2:c.2485C>T, NM_194248.2:c.2401G>T250,600
PAHPhenylketonuriaNM_000277.1NM_000277.1:c.1139C>T, NM_000277.1:c.1066-3C>T, NM_000277.1:c.117C>G, NM_000277.1:c.1166delC, NM_000277.1:c.1068C>A, NM_000277.1:c.1315+1G>A, NM_000277.1:c.1162G>A, NM_000277.1:c.143T>C, NM_000277.1:c.1243G>A, NM_000277.1:c.1169A>G, NM_000277.1:c.136G>A, NM_000277.1:c.1184C>A, NM_000277.1:c.194T>C, NM_000277.1:c.1199+17G>A, NM_000277.1:c.232G>A, NM_000277.1:c.1045T>C, NM_000277.1:c.1197A>T, NM_000277.1:c.441+1G>A, NM_000277.1:c.442-1G>A, NM_000277.1:c.442-5C>G, NM_000277.1:c.450_451insA, NM_000277.1:c.472C>T, NM_000277.1:c.204A>T, NM_000277.1:c.482T>C, NM_000277.1:c.250G>T, NM_000277.1:c.261C>A, NM_000277.1:c.1030G>A, NM_000277.1:c.1199+1G>A, NM_000277.1:c.1238G>C, NM_000277.1:c.1241A>G, NM_000277.1:c.673C>G, NM_000277.1:c.688G>A, NM_000277.1:c.721C>T, NM_000277.1:c.722delG, NM_000277.1:c.722G>A, NM_000277.1:c.727C>T, NM_000277.1:c.728G>A, NM_000277.1:c.733G>C, NM_000277.1:c.734T>C, NM_000277.1:c.737C>A, NM_000277.1:c.745C>T, NM_000277.1:c.1042C>G, NM_000277.1:c.638T>C, NM_000277.1:c.764T>C, NM_000277.1:c.782G>A, NM_000277.1:c.806delT, NM_000277.1:c.809G>A, NM_000277.1:c.814G>T, NM_000277.1:c.818C>T, NM_000277.1:c.823C>T, NM_000277.1:c.829T>G, NM_000277.1:c.898G>T, NM_000277.1:c.912+1G>A, NM_000277.1:c.284_286delTCA, NM_000277.1:c.754C>T, NM_000277.1:c.755G>A, NM_000277.1:c.357delC, NM_000277.1:c.1217T>C, NM_000277.1:c.1222C>T, NM_000277.1:c.157C>T, NM_000277.1:c.158G>A, NM_000277.1:c.165T>G, NM_000277.1:c.473G>A, NM_000277.1:c.490A>G, NM_000277.1:c.503delA, NM_000277.1:c.508C>G, NM_000277.1:c.533A>G, NM_000277.1:c.665A>G, NM_000277.1:c.838G>A, NM_000277.1:c.842+5G>A, NM_000277.1:c.896T>G, NM_000277.1:c.320A>G, NM_000277.1:c.441+5G>T, NM_000277.1:c.311C>A, NM_000277.1:c.527G>T, NM_000277.1:c.529G>A, NM_000277.1:c.47_48delCT, NM_000277.1:c.1208C>T, NM_000277.1:c.331C>T, NM_000277.1:c.926C>T, NM_000277.1:c.955G>T, NM_000277.1:c.926C>A, NM_000277.1:c.509+1G>A, NM_000277.1:c.1033G>T, NM_000277.1:c.611A>G, NM_000277.1:c.1066-11G>A, NM_000277.1:c.569T>C250,600
PALB2Fanconi anemia, complementation group NNM_024675.3NM_024675.3:c.1882_1890delAAGTCCTGC, NM_024675.3:c.2962C>T, NM_024675.3:c.50T>G, NM_024675.3:c.3116delA, NM_024675.3:c.3287A>G, NM_024675.3:c.3549C>G, NM_024675.3:c.3113G>A, NM_024675.3:c.2816T>G, NM_024675.3:c.1240C>T, NM_024675.3:c.557_558insA250,600
PANK2Pantothenate kinase-associated neurodegenerationNM_153638.2NM_153638.2:c.1561G>A, NM_153638.2:c.688G>A, NM_153638.2:c.790C>T, NM_153638.2:c.821_822delCT, NM_153638.2:c.1583C>T, NM_153638.2:c.1211A>T250,600
PAX3Waardenburg syndrome type 3NM_181457.3NM_181457.3:c.268T>C, NM_181457.3:c.251C>T600
PAX6AniridiaNM_000280.4NM_000280.4:c.1032+3A>T, NM_000280.4:c.978_979delCA, NM_000280.4:c.949C>T, NM_000280.4:c.1124C>A, NM_000280.4:c.1032+3_1032+6delAAGT, NM_000280.4:c.917-2A>T, NM_000280.4:c.1000_1001insTGGCATATAACCT, NM_000280.4:c.891delA, NM_000280.4:c.889dupC, NM_000280.4:c.890_905delAACCAATTCCACAACC, NM_000280.4:c.921_924dupCTCC, NM_000280.4:c.888C>G, NM_000280.4:c.887dupA, NM_000280.4:c.889C>T, NM_000280.4:c.888C>A, NM_000280.4:c.868_871dupAGTT, NM_000280.4:c.847_854dupAGTCATAT, NM_000280.4:c.879dupC, NM_000280.4:c.875G>T, NM_000280.4:c.839delA, NM_000280.4:c.829C>T, NM_000280.4:c.818delA, NM_000280.4:c.844_845delCC, NM_000280.4:c.812_813delTG, NM_000280.4:c.808A>T, NM_000280.4:c.799A>T, NM_000280.4:c.818dupA, NM_000280.4:c.794G>A, NM_000280.4:c.781C>T, NM_000280.4:c.775dupT, NM_000280.4:c.795G>A, NM_000280.4:c.1031A>G, NM_000280.4:c.1016_1019delATAA, NM_000280.4:c.1017delT, NM_000280.4:c.766-1G>C, NM_000280.4:c.766-2delA, NM_000280.4:c.760_765+9delATACAGGTACCGAGA, NM_000280.4:c.765G>C, NM_000280.4:c.765G>T, NM_000280.4:c.763C>T, NM_000280.4:c.742_752delGATCTACCTGA, NM_000280.4:c.745delC, NM_000280.4:c.916+2T>G, NM_000280.4:c.847_848dupAG, NM_000280.4:c.916+1G>C, NM_000280.4:c.689delA, NM_000280.4:c.683-2A>C, NM_000280.4:c.683-5_683-4delTTinsAAC, NM_000280.4:c.683-6T>A, NM_000280.4:c.683-9C>G, NM_000280.4:c.682+2T>A, NM_000280.4:c.673delC, NM_000280.4:c.668delA, NM_000280.4:c.656_665delAAGAGCAAAT, NM_000280.4:c.661C>T, NM_000280.4:c.658G>T, NM_000280.4:c.655C>T, NM_000280.4:c.646T>C, NM_000280.4:c.642A>C, NM_000280.4:c.639_640delTA, NM_000280.4:c.640A>G, NM_000280.4:c.640A>T, NM_000280.4:c.631C>T, NM_000280.4:c.623G>A, NM_000280.4:c.622C>T, NM_000280.4:c.613C>T, NM_000280.4:c.607C>T, NM_000280.4:c.601C>T, NM_000280.4:c.595G>T, NM_000280.4:c.580G>T, NM_000280.4:c.773T>C, NM_000280.4:c.771G>A, NM_000280.4:c.770G>A, NM_000280.4:c.766-1G>A, NM_000280.4:c.535C>T, NM_000280.4:c.534G>T, NM_000280.4:c.532C>T, NM_000280.4:c.524-2A>G, NM_000280.4:c.520C>T, NM_000280.4:c.500_501delCGinsGA, NM_000280.4:c.490_500delCCGGGGACTTCinsTCGGTA, NM_000280.4:c.500C>A, NM_000280.4:c.495delG, NM_000280.4:c.491delC, NM_000280.4:c.489T>G, NM_000280.4:c.480delT, NM_000280.4:c.475delC, NM_000280.4:c.470delG, NM_000280.4:c.468G>A, NM_000280.4:c.467G>A, NM_000280.4:c.464delG, NM_000280.4:c.459dupC, NM_000280.4:c.454C>T, NM_000280.4:c.450delC, NM_000280.4:c.432dupT, NM_000280.4:c.428_431delATGA, NM_000280.4:c.406C>T, NM_000280.4:c.403C>T, NM_000280.4:c.402delG, NM_000280.4:c.397G>T, NM_000280.4:c.383G>C, NM_000280.4:c.382C>T, NM_000280.4:c.366_379delAATAAACAGAGTTC, NM_000280.4:c.377T>A, NM_000280.4:c.375_376delAG, NM_000280.4:c.370_373delAACA, NM_000280.4:c.371delA, NM_000280.4:c.362_368dupCATCAAT, NM_000280.4:c.365C>A, NM_000280.4:c.362C>T, NM_000280.4:c.361T>C, NM_000280.4:c.358-1G>A, NM_000280.4:c.358-1G>C, NM_000280.4:c.357_357+5delCGTAAG, NM_000280.4:c.357+5G>A, NM_000280.4:c.357+2dupT, NM_000280.4:c.357+1G>A, NM_000280.4:c.357+1G>C, NM_000280.4:c.357+1G>T, NM_000280.4:c.349_357delATACCAAGC, NM_000280.4:c.339_357dupCAACGATAACATACCAAGC, NM_000280.4:c.353_357dupCAAGC, NM_000280.4:c.357C>G, NM_000280.4:c.357C>A, NM_000280.4:c.343_356dupGATAACATACCAAG, NM_000280.4:c.342_355delCGATAACATACCAA, NM_000280.4:c.350_354dupTACCA, NM_000280.4:c.353C>G, NM_000280.4:c.353C>A, NM_000280.4:c.348delC, NM_000280.4:c.344delA, NM_000280.4:c.331delG, NM_000280.4:c.331dupG, NM_000280.4:c.316_326delTTACTGTCCGA, NM_000280.4:c.316_326delTTACTGTCCGAinsCCCCCCGTT, NM_000280.4:c.325_326delGAinsCAG, NM_000280.4:c.325G>T, NM_000280.4:c.317T>A, NM_000280.4:c.307C>T, NM_000280.4:c.301delG, NM_000280.4:c.300G>A, NM_000280.4:c.299G>A, NM_000280.4:c.295G>C, NM_000280.4:c.284dupC, NM_000280.4:c.277G>A, NM_000280.4:c.277G>T, NM_000280.4:c.270delT, NM_000280.4:c.265dupC, NM_000280.4:c.265C>T, NM_000280.4:c.260T>G, NM_000280.4:c.260T>A, NM_000280.4:c.251dupT, NM_000280.4:c.236_244delCGACTCCAGinsTTGTAAGCAA, NM_000280.4:c.235_238dupGCGA, NM_000280.4:c.236_237delCGinsTTTGCTTACA, NM_000280.4:c.236C>A, NM_000280.4:c.233T>C, NM_000280.4:c.215_228delGTGGTAGTAAACCG, NM_000280.4:c.222_228dupTAAACCG, NM_000280.4:c.227C>G, NM_000280.4:c.220A>G, NM_000280.4:c.218G>A, NM_000280.4:c.215dupG, NM_000280.4:c.214G>A, NM_000280.4:c.210_213delAATCinsGGTAGTACACCCAG, NM_000280.4:c.202C>T, NM_000280.4:c.199A>T, NM_000280.4:c.191G>T, NM_000280.4:c.181_189delTACGAGACTinsCA, NM_000280.4:c.184_188dupGAGAC, NM_000280.4:c.187A>C, NM_000280.4:c.183delC, NM_000280.4:c.183C>A, NM_000280.4:c.177delG, NM_000280.4:c.175delA, NM_000280.4:c.170_174delTGGGC, NM_000280.4:c.164_170delAAATTCT, NM_000280.4:c.168delT, NM_000280.4:c.167T>C, NM_000280.4:c.164A>G, NM_000280.4:c.158_159delTG, NM_000280.4:c.157G>C, NM_000280.4:c.154T>C, NM_000280.4:c.142-1_153dupGGTGTCCAACGGA, NM_000280.4:c.152G>C, NM_000280.4:c.152G>T, NM_000280.4:c.151G>A, NM_000280.4:c.146C>T, NM_000280.4:c.143T>A, NM_000280.4:c.142delG, NM_000280.4:c.142-1G>T, NM_000280.4:c.555_556delGA, NM_000280.4:c.541G>T, NM_000280.4:c.539delA, NM_000280.4:c.538C>T, NM_000280.4:c.10+5G>C, NM_000280.4:c.10+3_10+4delAAinsGC, NM_000280.4:c.4delC, NM_000280.4:c.4C>T, NM_000280.4:c.3delG, NM_000280.4:c.1_2delATinsCA, NM_000280.4:c.2T>A, NM_000280.4:c.2T>G, NM_000280.4:c.1A>G, NM_000280.4:c.917-1G>C, NM_000280.4:c.736A>T, NM_000280.4:c.916+1G>A, NM_000280.4:c.711_712delGT, NM_000280.4:c.142-99A>G, NM_000280.4:c.901C>T, NM_000280.4:c.924delC, NM_000280.4:c.1032+2T>A, NM_000280.4:c.917-1G>A, NM_000280.4:c.142-3C>G, NM_000280.4:c.142-117T>A, NM_000280.4:c.1032+1G>A, NM_000280.4:c.718C>T, NM_000280.4:c.142-2A>G600
PCPyruvate carboxylase deficiencyNM_000920.3NM_000920.3:c.434T>C, NM_000920.3:c.1748G>T, NM_000920.3:c.496G>A250,600
PCCAPropionic acidemia type 1NM_000282.3NM_000282.3:c.1598_1601delTTGT, NM_000282.3:c.412G>A, NM_000282.3:c.1226_1227delTT, NM_000282.3:c.1891G>C, NM_000282.3:c.1899+1_1899+4delGTAA, NM_000282.3:c.1284+1G>A, NM_000282.3:c.229C>T, NM_000282.3:c.1023dupT, NM_000282.3:c.600+1G>A, NM_000282.3:c.261_262insT, NM_000282.3:c.1118T>A, NM_000282.3:c.862A>T250,600
PCCBPropionic acidemia type 2NM_000532.4NM_000532.4:c.1279_1291delGTTCCCinsAA, NM_000532.4:c.1283C>T, NM_000532.4:c.337C>T, NM_000532.4:c.1538_1540dupCCC, NM_000532.4:c.990dupT, NM_000532.4:c.1304A>G, NM_000532.4:c.1228C>T, NM_000532.4:c.1229_1230insT, NM_000532.4:c.1606A>G, NM_000532.4:c.1223_1226delTCAT, NM_000532.4:c.1490C>T, NM_000532.4:c.1534C>T, NM_000532.4:c.1173_1174insT, NM_000532.4:c.1540_1541insCCC, NM_000532.4:c.331C>T, NM_000532.4:c.683C>T, NM_000532.4:c.797G>T, NM_000532.4:c.737G>T, NM_000532.4:c.1218_1231delinsTAGAGCACAGGA, NM_000532.4:c.502G>A, NM_000532.4:c.562G>A, NM_000532.4:c.1219_1224delGGCATCinsAA250,600
PCDH15Usher syndrome type 1FNM_033056.3NM_033056.3:c.1583T>A, NM_033056.3:c.4885delA, NM_033056.3:c.4961_4962insTGAT, NM_033056.3:c.5659A>T, NM_033056.3:c.4937_4940dupTGAT, NM_033056.3:c.785G>A, NM_033056.3:c.5622_5624delAAC, NM_033056.3:c.400C>T, NM_033056.3:c.5724_5755delACGCACAAATGTTTCAGAACTTCAAACTATGT, NM_033056.3:c.4864delA, NM_033056.3:c.1737C>G, NM_033056.3:c.1021C>T, NM_033056.3:c.1088delT, NM_033056.3:c.1006C>T, NM_033056.3:c.1940C>G, NM_033056.3:c.400C>G, NM_033056.3:c.3718-2A>G, NM_033056.3:c.4548_4551dupATCT, NM_033056.3:c.7C>T, NM_033056.3:c.2645_2646delAT250,600
PDE6ARetinitis pigmentosa type 43NM_000440.2NM_000440.2:c.1683G>A, NM_000440.2:c.1113+1G>T, NM_000440.2:c.718-4_718-3insT, NM_000440.2:c.1749C>G, NM_000440.2:c.2053G>A, NM_000440.2:c.1560_1561insA, NM_000440.2:c.304C>A, NM_000440.2:c.1040C>T, NM_000440.2:c.1113+1G>A250,600
PDE6BRetinitis pigmentosa type 43NM_000283.3NM_000283.3:c.1580T>C, NM_000283.3:c.655T>C, NM_000283.3:c.1540delC, NM_000283.3:c.1572delC, NM_000283.3:c.1920+2T>C, NM_000283.3:c.1669C>T, NM_000283.3:c.892C>T250,600
PDE6CCone dystrophy type 4NM_006204.3NM_006204.3:c.1682dupA, NM_006204.3:c.1805A>T, NM_006204.3:c.2283+1G>C, NM_006204.3:c.256_257insAG, NM_006204.3:c.1066G>T, NM_006204.3:c.881G>A, NM_006204.3:c.481-12T>A, NM_006204.3:c.1363A>G, NM_006204.3:c.2457T>A, NM_006204.3:c.826C>T, NM_006204.3:c.633G>C, NM_006204.3:c.2036+1G>T, NM_006204.3:c.85C>T, NM_006204.3:c.180_186delCCTGTGC600
PDE6GRetinitis pigmentosa type 57NM_002602.3NM_002602.3:c.187+1G>T600
PDHA1Pyruvate dehydrogenase E1-alpha deficiencyNM_000284.3NM_000284.3:c.262C>T, NM_000284.3:c.787C>G, NM_000284.3:c.871G>A, NM_000284.3:c.773A>C600
PDP1Pyruvate dehydrogenase phosphatase deficiencyNM_018444.3NM_018444.3:c.597_601delCTTTA, NM_018444.3:c.1606C>T, NM_018444.3:c.277G>T, NM_018444.3:c.803delC, NM_018444.3:c.669_673delTTACT, NM_018444.3:c.672_676delCTTTA, NM_018444.3:c.878delC, NM_018444.3:c.851_853delTTC600
PDSS1Coenzyme Q10 deficiency, primary, type 2NM_014317.3NM_014317.3:c.319dupT, NM_014317.3:c.924T>G600
PDSS2Coenzyme Q10 deficiency, primary, type 3NM_020381.3NM_020381.3:c.964C>T, NM_020381.3:c.129_130insC, NM_020381.3:c.1145C>T600
PDX1Pancreatic agenesisNM_000209.3NM_000209.3:c.532G>A, NM_000209.3:c.533A>G, NM_000209.3:c.492G>T600
PDZD7Usher syndrome type 2CNM_001195263.1NM_001195263.1:c.1543C>T, NM_001195263.1:c.166_167insC, NM_001195263.1:c.2107delA, NM_001195263.1:c.144_145insA600
PEX1Peroxisome biogenesis disorder type 1ANM_000466.2NM_000466.2:c.2097dupT, NM_000466.2:c.2916delA, NM_000466.2:c.1842delA, NM_000466.2:c.1991T>C, NM_000466.2:c.1239+1G>T250,600
PEX1Peroxisome biogenesis disorder type 1BNM_000466.2NM_000466.2:c.2097_2098insT, NM_000466.2:c.1952_1960dupCAGTGTGGA, NM_000466.2:c.877C>T, NM_000466.2:c.3505_3517delCAGTTGTTTTCAC, NM_000466.2:c.2528G>A250,600
PEX12Peroxisome biogenesis disorder complementation group 6NM_000286.2NM_000286.2:c.959C>T, NM_000286.2:c.894delC, NM_000286.2:c.888_889delCT, NM_000286.2:c.538C>T, NM_000286.2:c.455_459dupGGAAA, NM_000286.2:c.771delC600
PEX2Peroxisome biogenesis disorder complementation group 5NM_000318.2NM_000318.2:c.163G>A, NM_000318.2:c.789_790delCT600
PEX26Peroxisome biogenesis disorder type 7NM_017929.5NM_017929.5:c.292C>T, NM_017929.5:c.254dupT, NM_017929.5:c.265G>A, NM_017929.5:c.353C>G600
PEX5Peroxisome biogenesis disorder type 2NM_001131025.1NM_001131025.1:c.1578T>G, NM_001131025.1:c.1279C>T, NM_001131025.1:c.*20G>C600
PEX7Rhizomelic chondrodysplasia punctata type 1NM_000288.3NM_000288.3:c.694C>T, NM_000288.3:c.649G>A, NM_000288.3:c.618G>A, NM_000288.3:c.722A>T, NM_000288.3:c.875T>A, NM_000288.3:c.653C>T, NM_000288.3:c.854A>G, NM_000288.3:c.532C>T, NM_000288.3:c.903+1G>C250,600
PGM1Congenital disorder of glycosylation, type 1TNM_002633.2NM_002633.2:c.343A>G, NM_002633.2:c.361G>C, NM_002633.2:c.1507C>T, NM_002633.2:c.300+1G>A, NM_002633.2:c.787G>T600
PHKG2Glycogen storage disease type 9CNM_000294.2NM_000294.2:c.958C>T, NM_000294.2:c.553C>T, NM_000294.2:c.130C>T, NM_000294.2:c.393-2A>G600
PHYHRefsum diseaseNM_006214.3NM_006214.3:c.135-2A>G, NM_006214.3:c.497-2A>G, NM_006214.3:c.135-1G>C, NM_006214.3:c.805A>C, NM_006214.3:c.678+5G>T, NM_006214.3:c.823C>T, NM_006214.3:c.530A>G, NM_006214.3:c.164delT, NM_006214.3:c.678+2T>G, NM_006214.3:c.824G>A250,600
PKHD1Polycystic kidney disease, autosomal recessiveNM_138694.3NM_138694.3:c.10515C>A, NM_138694.3:c.11363_11372delCTTCCCTGGA, NM_138694.3:c.10585G>C, NM_138694.3:c.107C>T, NM_138694.3:c.10452dupT, NM_138694.3:c.2452C>T, NM_138694.3:c.2747A>C, NM_138694.3:c.12027C>G, NM_138694.3:c.11284C>A, NM_138694.3:c.3367G>A, NM_138694.3:c.353delG, NM_138694.3:c.2827_2828delGA, NM_138694.3:c.2854G>A, NM_138694.3:c.1342G>C, NM_138694.3:c.1409G>A, NM_138694.3:c.11611T>C, NM_138694.3:c.3761_3762delCCinsG, NM_138694.3:c.2414C>T, NM_138694.3:c.5895_5896insA, NM_138694.3:c.5895dupA, NM_138694.3:c.6499C>T, NM_138694.3:c.664A>G, NM_138694.3:c.682A>G, NM_138694.3:c.6854G>A, NM_138694.3:c.370C>T, NM_138694.3:c.8407T>C, NM_138694.3:c.3766delC, NM_138694.3:c.3940delA, NM_138694.3:c.1486C>T, NM_138694.3:c.2341C>T, NM_138694.3:c.10219C>T, NM_138694.3:c.9107T>G, NM_138694.3:c.930delC, NM_138694.3:c.9370C>T, NM_138694.3:c.9530T>C, NM_138694.3:c.9689delA, NM_138694.3:c.982C>T, NM_138694.3:c.9866G>T, NM_138694.3:c.10036T>C, NM_138694.3:c.3229-2A>C, NM_138694.3:c.4870C>T, NM_138694.3:c.4165C>A, NM_138694.3:c.9719G>A, NM_138694.3:c.5325_5326delAG, NM_138694.3:c.5498C>T, NM_138694.3:c.8824C>T, NM_138694.3:c.85G>T, NM_138694.3:c.10412T>G, NM_138694.3:c.8518C>T, NM_138694.3:c.8408G>A, NM_138694.3:c.8317G>T, NM_138694.3:c.8870T>C250,600
PKLRHemolytic anemia due to red cell pyruvate kinase deficiencyNM_000298.5NM_000298.5:c.1151C>T, NM_000298.5:c.1706G>A, NM_000298.5:c.1529G>A, NM_000298.5:c.1528C>T, NM_000298.5:c.1595G>A, NM_000298.5:c.721G>T, NM_000298.5:c.1076G>A, NM_000298.5:c.1675C>T, NM_000298.5:c.1261C>A, NM_000298.5:c.1436G>A, NM_000298.5:c.1456C>T250,600
PLA2G6Infantile neuroaxonal dystrophyNM_003560.2NM_003560.2:c.1634A>C, NM_003560.2:c.238G>A, NM_003560.2:c.1903C>T, NM_003560.2:c.109C>T, NM_003560.2:c.1612C>T, NM_003560.2:c.2370T>G, NM_003560.2:c.929T>A, NM_003560.2:c.1894C>T, NM_003560.2:c.2239C>T600
PLCE1Nephrotic syndrome type 3NM_016341.3NM_016341.3:c.3346C>T, NM_016341.3:c.4808delA, NM_016341.3:c.3846delG, NM_016341.3:c.3736C>T, NM_016341.3:c.5560C>T, NM_016341.3:c.4451C>T, NM_016341.3:c.5669C>T, NM_016341.3:c.961C>T250,600
PLECEpidermolysis bullosa simplex with muscular dystrophyNM_000445.4NM_000445.4:c.6955C>T, NM_000445.4:c.9250_9251delCT, NM_000445.4:c.10971_10972delGA, NM_000445.4:c.2493+1G>C600
PLECEpidermolysis bullosa simplex with pyloric atresiaNM_000445.4NM_000445.4:c.9085C>T, NM_000445.4:c.913C>T, NM_000445.4:c.906+1G>A, NM_000445.4:c.12043_12044insG, NM_000445.4:c.11446G>T600
PLEKHG5Charcot-Marie-Tooth disease, intermediate type CNM_020631.4NM_020631.4:c.440-2A>G, NM_020631.4:c.3166C>T, NM_020631.4:c.1940T>C, NM_020631.4:c.2935C>T600
PLGCongenital plasminogen deficiency type 1NM_000301.3NM_000301.3:c.704G>A, NM_000301.3:c.1848G>A, NM_000301.3:c.1435G>T, NM_000301.3:c.693_695delGAA, NM_000301.3:c.1120G>T, NM_000301.3:c.112A>G250,600
PLOD1Ehlers-Danlos syndrome, type 6NM_000302.3NM_000302.3:c.955C>T, NM_000302.3:c.2032G>A, NM_000302.3:c.1533C>G, NM_000302.3:c.1836G>C, NM_000302.3:c.2008C>T, NM_000302.3:c.466+1G>A600
PLP1Pelizaeus-Merzbacher diseaseNM_000533.3NM_000533.3:c.128C>T, NM_000533.3:c.593delG, NM_000533.3:c.231_232insC, NM_000533.3:c.3G>A, NM_000533.3:c.487T>C, NM_000533.3:c.725C>T, NM_000533.3:c.737G>C, NM_000533.3:c.169G>T600
PLP1Spastic paraplegia type 2, X-linkedNM_000533.3NM_000533.3:c.409C>T600
PMM2Congenital disorders of glycosylation type 1aNM_000303.2NM_000303.2:c.349G>C, NM_000303.2:c.357C>A, NM_000303.2:c.255+2T>C, NM_000303.2:c.127G>C, NM_000303.2:c.395T>C, NM_000303.2:c.415G>A, NM_000303.2:c.368G>A, NM_000303.2:c.385G>A, NM_000303.2:c.470T>C, NM_000303.2:c.484C>T, NM_000303.2:c.422G>A, NM_000303.2:c.442G>A, NM_000303.2:c.623G>C, NM_000303.2:c.647A>T, NM_000303.2:c.652C>G, NM_000303.2:c.323C>T, NM_000303.2:c.677C>G, NM_000303.2:c.691G>A, NM_000303.2:c.710C>G, NM_000303.2:c.669C>G, NM_000303.2:c.95_96delTAinsGC, NM_000303.2:c.95T>G, NM_000303.2:c.53C>G, NM_000303.2:c.710C>T, NM_000303.2:c.620T>C, NM_000303.2:c.97C>T, NM_000303.2:c.193G>T, NM_000303.2:c.338C>T, NM_000303.2:c.563A>G, NM_000303.2:c.131T>C, NM_000303.2:c.26G>A, NM_000303.2:c.109C>T, NM_000303.2:c.317A>T, NM_000303.2:c.190delT, NM_000303.2:c.256-1G>C250,600
PNPOPNPO deficiencyNM_018129.3NM_018129.3:c.685C>T, NM_018129.3:c.674G>A600
POLGMitochondrial DNA depletion syndrome, Alpers typeNM_002693.2NM_002693.2:c.2617G>T, NM_002693.2:c.1120C>T, NM_002693.2:c.830A>T, NM_002693.2:c.3218C>T, NM_002693.2:c.3630dupC250,600
POLGProgressive external ophthalmoplegiaNM_002693.2NM_002693.2:c.1437C>G, NM_002693.2:c.2591A>G, NM_002693.2:c.1754G>A, NM_002693.2:c.1399G>A, NM_002693.2:c.1491G>C, NM_002693.2:c.3151G>C, NM_002693.2:c.803G>C, NM_002693.2:c.3286C>T, NM_002693.2:c.2794C>T, NM_002693.2:c.752C>T, NM_002693.2:c.3644-1G>A, NM_002693.2:c.1879C>T, NM_002693.2:c.2605C>T, NM_002693.2:c.911T>G, NM_002693.2:c.1760C>T, NM_002693.2:c.2542G>A, NM_002693.2:c.1550G>T, NM_002693.2:c.2557C>T, NM_002693.2:c.2207A>G, NM_002693.2:c.2243G>C, NM_002693.2:c.2209G>C250,600
POMGNT1Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies) type A3NM_017739.3NM_017739.3:c.1425G>A, NM_017739.3:c.1545delC, NM_017739.3:c.1274G>C, NM_017739.3:c.1864delC, NM_017739.3:c.1411A>T, NM_017739.3:c.1469G>A, NM_017739.3:c.1539+1G>A, NM_017739.3:c.92dupA, NM_017739.3:c.1539+1G>T, NM_017739.3:c.932G>A, NM_017739.3:c.794G>A, NM_017739.3:c.880-1G>A, NM_017739.3:c.652+1G>A, NM_017739.3:c.931C>T, NM_017739.3:c.1666G>A, NM_017739.3:c.1814G>C, NM_017739.3:c.636C>T, NM_017739.3:c.187C>T250,600
POMT1Congenital muscular dystrophy with intellectual disability type B1NM_007171.3NM_007171.3:c.598G>C, NM_007171.3:c.193G>A, NM_007171.3:c.1770G>C, NM_007171.3:c.2005G>A, NM_007171.3:c.2163C>A, NM_007171.3:c.1746G>C, NM_007171.3:c.793C>T250,600
POMT1Walker-Warburg syndromeNM_007171.3NM_007171.3:c.1540C>T, NM_007171.3:c.226G>A, NM_007171.3:c.1611C>G, NM_007171.3:c.1242-2A>G, NM_007171.3:c.907C>T, NM_007171.3:c.2163_2164insG, NM_007171.3:c.2167dupG, NM_007171.3:c.1153C>T, NM_007171.3:c.1261_1262insC, NM_007171.3:c.831C>G, NM_007171.3:c.1545C>G, NM_007171.3:c.1280_1281delAGinsTC250,600
POMT2Congenital muscular dystrophy with intellectual disability type A2NM_013382.5NM_013382.5:c.2243G>C, NM_013382.5:c.1997A>G, NM_013382.5:c.2242T>C, NM_013382.5:c.1445G>T, NM_013382.5:c.2177G>A, NM_013382.5:c.1238G>C, NM_013382.5:c.1941G>A, NM_013382.5:c.1057G>A, NM_013382.5:c.551C>T250,600
POMT2Walker-Warburg syndromeNM_013382.5NM_013382.5:c.1726-2A>G, NM_013382.5:c.1417C>T, NM_013382.5:c.1912C>T, NM_013382.5:c.1608_1609delCA, NM_013382.5:c.1045_1052delinsG250,600
POU1F1Pituitary hormone deficiency, combined, type 1NM_000306.3NM_000306.3:c.472G>C, NM_000306.3:c.428G>A, NM_000306.3:c.577T>C, NM_000306.3:c.514C>T, NM_000306.3:c.515G>A, NM_000306.3:c.71C>T, NM_000306.3:c.433A>T, NM_000306.3:c.715C>T, NM_000306.3:c.515G>C, NM_000306.3:c.391G>T, NM_000306.3:c.688G>A, NM_000306.3:c.793C>T, NM_000306.3:c.748G>T, NM_000306.3:c.811C>T, NM_000306.3:c.404T>G600
POU3F4Deafness type 2, X-linkedNM_000307.4NM_000307.4:c.604A>T, NM_000307.4:c.499C>T600
PPT1Neuronal ceroid-lipofuscinoses type 1NM_000310.3NM_000310.3:c.29T>A, NM_000310.3:c.223A>C, NM_000310.3:c.627+1G>T, NM_000310.3:c.169_170insA, NM_000310.3:c.451C>T, NM_000310.3:c.541G>T, NM_000310.3:c.840_841insA250,600
PRCDRetinitis pigmentosa 36NM_001077620.2NM_001077620.2:c.64C>T, NM_001077620.2:c.52C>T600
PRKRADystonia tipo 16NM_003690.4NM_003690.4:c.665C>T600
PRODHHyperprolinemia type 1NM_016335.4NM_016335.4:c.865T>A, NM_016335.4:c.1331G>A250,600
PROM1Retinitis pigmentosa type 41NM_006017.2NM_006017.2:c.1841delG, NM_006017.2:c.1354_1355insT, NM_006017.2:c.1726C>T, NM_006017.2:c.199C>T, NM_006017.2:c.2490-2A>G, NM_006017.2:c.1177_1178delAT250,600
PROP1Pituitary hormone deficiency, combined, type 2NM_006261.4NM_006261.4:c.2T>C, NM_006261.4:c.150delA, NM_006261.4:c.349T>A, NM_006261.4:c.112_124delTCGAGTGCTCCAC, NM_006261.4:c.310delC, NM_006261.4:c.343-11C>G, NM_006261.4:c.217C>T, NM_006261.4:c.218G>A, NM_006261.4:c.373C>T, NM_006261.4:c.157delA, NM_006261.4:c.295C>T, NM_006261.4:c.469_470insT, NM_006261.4:c.301_302delAG, NM_006261.4:c.358C>T, NM_006261.4:c.247C>T, NM_006261.4:c.263T>C, NM_006261.4:c.4delG600
PRPS1Charcot-Marie-Tooth disease type 5, X-linked recessiveNM_002764.3NM_002764.3:c.344T>C600
PRPS1Deafness, X-linkedNM_002764.3NM_002764.3:c.916G>A, NM_002764.3:c.869T>C600
PRPS1Phosphoribosylpyrophosphate synthetase superactivityNM_002764.3NM_002764.3:c.398A>C, NM_002764.3:c.455T>C600
PRPS1Sensorineural deafness, nonsyndromic, X-linkedNM_002764.3NM_002764.3:c.193G>A600
PRXCharcot-Marie-Tooth disease type 4FNM_181882.2NM_181882.2:c.2553_2556delTCTC, NM_181882.2:c.1362delA, NM_181882.2:c.1951G>A, NM_181882.2:c.3208C>T, NM_181882.2:c.2145T>A, NM_181882.2:c.2098delG600
PRXDejerine-Sottas syndrome (PRX)NM_181882.2NM_181882.2:c.247delC, NM_181882.2:c.1102C>T, NM_181882.2:c.2857C>T600
PSAPAtypical Gaucher disease due to saposin C deficiencyNM_002778.2NM_002778.2:c.643A>C, NM_002778.2:c.607C>T, NM_002778.2:c.1A>T, NM_002778.2:c.1046T>C, NM_002778.2:c.1288C>T600
PSAT1Phosphoserine aminotransferase deficiencyNM_058179.3NM_058179.3:c.1029_1030delCT, NM_058179.3:c.299A>C600
PYGMMcArdle diseaseNM_005609.2NM_005609.2:c.1628A>C, NM_005609.2:c.1466C>G, NM_005609.2:c.1094C>T, NM_005609.2:c.1827G>A, NM_005609.2:c.13_14delCT, NM_005609.2:c.1A>G, NM_005609.2:c.2009C>T, NM_005609.2:c.2128_2130delTTC, NM_005609.2:c.393delG, NM_005609.2:c.2392T>C, NM_005609.2:c.148C>T, NM_005609.2:c.1621G>T, NM_005609.2:c.613G>A, NM_005609.2:c.1963G>A, NM_005609.2:c.2262delA, NM_005609.2:c.1722T>G, NM_005609.2:c.255C>A, NM_005609.2:c.280C>T, NM_005609.2:c.1768+1G>A, NM_005609.2:c.501dupT, NM_005609.2:c.481C>T, NM_005609.2:c.1726C>T250,600
RAB23Carpenter syndromeNM_183227.2NM_183227.2:c.407dupC, NM_183227.2:c.434T>A600
RAB27AGriscelli syndrome, type 2NM_004580.4NM_004580.4:c.259G>C, NM_004580.4:c.382dupA, NM_004580.4:c.217T>G, NM_004580.4:c.352C>T, NM_004580.4:c.389T>C, NM_004580.4:c.454G>C600
RAB3GAP1Warburg micro syndrome type 1NM_012233.2NM_012233.2:c.1734G>A, NM_012233.2:c.496_497delTT, NM_012233.2:c.937dupA, NM_012233.2:c.1393_1396delTGTA, NM_012233.2:c.1410C>A, NM_012233.2:c.899+1G>A, NM_012233.2:c.2011C>T, NM_012233.2:c.748+1G>A600
RAB3GAP2Warburg micro syndrome type 2NM_012414.3NM_012414.3:c.1648C>T, NM_012414.3:c.1485C>A, NM_012414.3:c.325_328delAAAG, NM_012414.3:c.1276C>T600
RAD51CFanconi anemia, complementation group ONM_058216.2NM_058216.2:c.706-2A>G, NM_058216.2:c.838-2A>T, NM_058216.2:c.133G>A, NM_058216.2:c.773G>A600
RAG1Immunodeficiency severe combined B cell-negativeNM_000448.2NM_000448.2:c.2333G>A, NM_000448.2:c.2320G>T, NM_000448.2:c.2164G>A, NM_000448.2:c.940C>T, NM_000448.2:c.2814T>G, NM_000448.2:c.2923C>T, NM_000448.2:c.2326C>T250,600
RAG1Omenn syndromeNM_000448.2NM_000448.2:c.983G>A, NM_000448.2:c.3016A>G, NM_000448.2:c.256_257delAA, NM_000448.2:c.1682G>A, NM_000448.2:c.1681C>T250,600
RAG2Combined immunodeficiency with skin granulomasNM_000536.3NM_000536.3:c.115A>G, NM_000536.3:c.686G>A, NM_000536.3:c.283G>A, NM_000536.3:c.601C>T, NM_000536.3:c.230C>A, NM_000536.3:c.1352G>C600
RAG2Omenn syndromeNM_000536.3NM_000536.3:c.685C>T, NM_000536.3:c.1504A>G600
RAPSNCongenital myasthenic syndromeNM_005055.4NM_005055.4:c.484G>A, NM_005055.4:c.264C>A, NM_005055.4:c.807C>A, NM_005055.4:c.848T>C, NM_005055.4:c.490C>T, NM_005055.4:c.603C>A250,600
RAPSNFetal akinesia deformation sequenceNM_005055.4NM_005055.4:c.416T>C, NM_005055.4:c.566C>T250,600
RAXIsolated microphthalmia type 3NM_013435.2NM_013435.2:c.909C>G, NM_013435.2:c.18C>A, NM_013435.2:c.197G>C, NM_013435.2:c.439C>T, NM_013435.2:c.383_384delAG250,600
RDH12Leber congenital amaurosis type 13NM_152443.2NM_152443.2:c.184C>T, NM_152443.2:c.146C>T, NM_152443.2:c.152T>A, NM_152443.2:c.451C>A, NM_152443.2:c.295C>A, NM_152443.2:c.377C>T, NM_152443.2:c.379G>T, NM_152443.2:c.565C>T, NM_152443.2:c.677A>G, NM_152443.2:c.805_809delGCCCT, NM_152443.2:c.164C>T, NM_152443.2:c.210dupC, NM_152443.2:c.448+1_448+4delGTAA, NM_152443.2:c.451C>G, NM_152443.2:c.464C>T, NM_152443.2:c.523T>C250,600
RDXDeafness type 24, autosomal recessiveNM_002906.3NM_002906.3:c.1405dupG, NM_002906.3:c.342_346delGATAT600
RELNLissencephaly syndrome, Norman-Roberts typeNM_005045.3NM_005045.3:c.6646C>T, NM_005045.3:c.5615-1G>A600
RENRenal tubular dysgenesisNM_000537.3NM_000537.3:c.404C>A, NM_000537.3:c.127C>T, NM_000537.3:c.145C>T600
RGRRetinitis pigmentosa type 44NM_001012720.1NM_001012720.1:c.196A>C, NM_001012720.1:c.249_250insGGCTCGGA, NM_001012720.1:c.261_262insGGCTCGGA, NM_001012720.1:c.454C>A, NM_001012720.1:c.865C>T, NM_001012720.1:c.877C>T250,600
RHORetinitis pigmentosa type 4NM_000539.3NM_000539.3:c.152G>C, NM_000539.3:c.173C>T, NM_000539.3:c.448G>A, NM_000539.3:c.620T>G, NM_000539.3:c.670G>A, NM_000539.3:c.745G>T, NM_000539.3:c.659T>G250,600
RLBP1Retinitis punctata albescensNM_000326.4NM_000326.4:c.333T>G, NM_000326.4:c.452G>A, NM_000326.4:c.700C>T, NM_000326.4:c.875C>T250,600
RP2Retinitis pigmentosa type 2NM_006915.2NM_006915.2:c.235delG, NM_006915.2:c.305_306insT, NM_006915.2:c.352delC, NM_006915.2:c.353G>A, NM_006915.2:c.353G>T, NM_006915.2:c.358C>T, NM_006915.2:c.453C>G, NM_006915.2:c.453delC, NM_006915.2:c.631delC600
RPE65Leber congenital amaurosis type 2NM_000329.2NM_000329.2:c.1067delA, NM_000329.2:c.1301C>T, NM_000329.2:c.1292A>G, NM_000329.2:c.272G>A, NM_000329.2:c.907A>T, NM_000329.2:c.514_515delGT250,600
RPE65Retinitis pigmentosa type 20NM_000329.2NM_000329.2:c.1022T>C, NM_000329.2:c.1087C>A, NM_000329.2:c.1102T>C, NM_000329.2:c.271C>T, NM_000329.2:c.1355T>G, NM_000329.2:c.1543C>T, NM_000329.2:c.394G>A, NM_000329.2:c.881A>C250,600
RPGRRetinitis pigmentosa type 3NM_001034853.1NM_001034853.1:c.155-2A>G, NM_001034853.1:c.173_174insA, NM_001034853.1:c.179G>T, NM_001034853.1:c.296C>A, NM_001034853.1:c.389T>G, NM_001034853.1:c.505G>T, NM_001034853.1:c.517G>C, NM_001034853.1:c.642_656delTGGAGAACCTGAGAAinsC, NM_001034853.1:c.654_655delGA, NM_001034853.1:c.674_675delCC, NM_001034853.1:c.703C>T, NM_001034853.1:c.806G>A, NM_001034853.1:c.823G>A, NM_001034853.1:c.846_847delAA600
RPGRIP1LJoubert syndrome type 7NM_015272.2NM_015272.2:c.1177G>A, NM_015272.2:c.1326_1329delAAAA, NM_015272.2:c.1329_1330insA, NM_015272.2:c.1843A>C, NM_015272.2:c.1975T>C, NM_015272.2:c.2030C>T, NM_015272.2:c.2050C>T, NM_015272.2:c.2413C>T, NM_015272.2:c.757C>T, NM_015272.2:c.3548C>G, NM_015272.2:c.697A>T, NM_015272.2:c.3634_3637delGAAA, NM_015272.2:c.776+1G>A, NM_015272.2:c.2794_2795delTT250,600
RPGRIP1LMeckel syndrome type 5NM_015272.2NM_015272.2:c.394A>T, NM_015272.2:c.3706C>T, NM_015272.2:c.2614C>T250,600
RYR1Central core diseaseNM_000540.2NM_000540.2:c.1021G>A, NM_000540.2:c.10343C>T, NM_000540.2:c.10579C>T, NM_000540.2:c.10616G>A, NM_000540.2:c.11798A>G, NM_000540.2:c.1205T>C, NM_000540.2:c.13480G>T, NM_000540.2:c.13513G>C, NM_000540.2:c.14365-2A>T, NM_000540.2:c.14511+1_14511+2delGT, NM_000540.2:c.14545G>A, NM_000540.2:c.1739_1742dupATCA, NM_000540.2:c.1841G>T, NM_000540.2:c.325C>T, NM_000540.2:c.4076delG, NM_000540.2:c.4178A>G, NM_000540.2:c.4405C>T, NM_000540.2:c.487C>T, NM_000540.2:c.5036G>A, NM_000540.2:c.5333C>A, NM_000540.2:c.5726_5727delAG, NM_000540.2:c.6082C>T, NM_000540.2:c.6104A>T, NM_000540.2:c.631+2T>C, NM_000540.2:c.6961A>G, NM_000540.2:c.7025A>G, NM_000540.2:c.7268T>A, NM_000540.2:c.7300G>A, NM_000540.2:c.7360C>T, NM_000540.2:c.7373G>A, NM_000540.2:c.738T>G, NM_000540.2:c.7463_7475delCAAAGATGTCAGC, NM_000540.2:c.9000+1G>T, NM_000540.2:c.14126C>T, NM_000540.2:c.1655G>A, NM_000540.2:c.4729G>A, NM_000540.2:c.7781C>A, NM_000540.2:c.7836-1G>A, NM_000540.2:c.8360C>G, NM_000540.2:c.9868G>A, NM_000540.2:c.9905_9906insC, NM_000540.2:c.1186G>T, NM_000540.2:c.6721C>T250,600
SACSSpastic ataxia, Charlevoix-Saguenay typeNM_014363.5NM_014363.5:c.10907G>A, NM_014363.5:c.10954C>A, NM_014363.5:c.11624G>A, NM_014363.5:c.12160C>T, NM_014363.5:c.517C>T, NM_014363.5:c.6355C>T, NM_014363.5:c.6781C>A, NM_014363.5:c.7504C>T, NM_014363.5:c.8107C>T, NM_014363.5:c.8844delT, NM_014363.5:c.994A>T, NM_014363.5:c.13237C>T, NM_014363.5:c.3198T>A, NM_014363.5:c.4933C>T, NM_014363.5:c.5618_5619delAT, NM_014363.5:c.6563T>A250,600
SAGOguchi diseaseNM_000541.4NM_000541.4:c.293_294insG, NM_000541.4:c.523C>T, NM_000541.4:c.577C>T, NM_000541.4:c.874C>T, NM_000541.4:c.916G>T, NM_000541.4:c.926delA, NM_000541.4:c.993C>G250,600
SBDSShwachman-Diamond syndromeNM_016038.2NM_016038.2:c.120delG, NM_016038.2:c.127G>T, NM_016038.2:c.183_184delTAinsCT, NM_016038.2:c.184A>T, NM_016038.2:c.377G>C, NM_016038.2:c.505C>T, NM_016038.2:c.258+2T>C250,600
SBF2Charcot-Marie-Tooth disease type 4B2NM_030962.3NM_030962.3:c.1459C>T, NM_030962.3:c.2875C>T, NM_030962.3:c.3586C>T, NM_030962.3:c.3154A>T, NM_030962.3:c.5539_5540insATCT600
SC5DLathosterolosisNM_006918.4NM_006918.4:c.86G>A600
SCNN1APseudohypoaldosteronism, type 1NM_001038.5NM_001038.5:c.1305delC, NM_001038.5:c.1482delC, NM_001038.5:c.1522C>T, NM_001038.5:c.1765C>T, NM_001038.5:c.1834C>T, NM_001038.5:c.203_204delTC, NM_001038.5:c.340G>A600
SCNN1BPseudohypoaldosteronism, type 1NM_000336.2NM_000336.2:c.109G>A250,600
SCNN1GPseudohypoaldosteronism, type 1NM_001039.3NM_001039.3:c.1373+2T>C, NM_001039.3:c.1570-1G>A, NM_001039.3:c.1627delG, NM_001039.3:c.598_599insA250,600
SEMA4ARetinitis pigmentosa type 35NM_022367.3NM_022367.3:c.1033G>C, NM_022367.3:c.1049T>G600
SEPN1Muscular dystrophy, rigid spine, type 1NM_020451.2NM_020451.2:c.1315C>T, NM_020451.2:c.818G>A, NM_020451.2:c.883G>A, NM_020451.2:c.943G>A, NM_020451.2:c.943G>C, NM_020451.2:c.1384T>G, NM_020451.2:c.713_714insA, NM_020451.2:c.871C>T600
SERPINA1Alpha1-antitrypsin deficiencyNM_000295.4NM_000295.4:c.1177C>T, NM_000295.4:c.187C>T, NM_000295.4:c.194T>C, NM_000295.4:c.230C>T, NM_000295.4:c.250G>A, NM_000295.4:c.272G>A, NM_000295.4:c.347T>A, NM_000295.4:c.415G>A, NM_000295.4:c.514G>A, NM_000295.4:c.514G>T, NM_000295.4:c.739C>T, NM_000295.4:c.839A>T, NM_000295.4:c.1093G>A, NM_000295.4:c.848A>T250,600
SETXSpinocerebellar ataxia with axonal neuropathy type 2NM_015046.5NM_015046.5:c.1027G>T, NM_015046.5:c.1166T>C, NM_015046.5:c.1807A>G, NM_015046.5:c.2602C>T, NM_015046.5:c.3880C>T, NM_015046.5:c.4087C>T, NM_015046.5:c.5630delG, NM_015046.5:c.5927T>G, NM_015046.5:c.6848_6851delCAGA, NM_015046.5:c.994C>T, NM_015046.5:c.5308_5311delGAGA, NM_015046.5:c.5549-1G>T, NM_015046.5:c.6834_6839delAACAAA250,600
SGCALimb-girdle muscular dystrophy type 2DNM_000023.2NM_000023.2:c.101G>A, NM_000023.2:c.229C>T, NM_000023.2:c.371T>C, NM_000023.2:c.518T>C, NM_000023.2:c.574C>T, NM_000023.2:c.850C>T, NM_000023.2:c.662G>A, NM_000023.2:c.739G>A, NM_000023.2:c.904_905insCC250,600
SGCBMuscular dystrophy, limb-girdle, type 2ENM_000232.4NM_000232.4:c.272G>C, NM_000232.4:c.272G>T, NM_000232.4:c.299T>A, NM_000232.4:c.323T>G, NM_000232.4:c.341C>T, NM_000232.4:c.452C>G, NM_000232.4:c.552T>G600
SGCGLimb-girdle muscular dystrophy type 2CNM_000231.2NM_000231.2:c.195+4_195+7delAGTA, NM_000231.2:c.505+1G>A, NM_000231.2:c.787G>A, NM_000231.2:c.848G>A, NM_000231.2:c.88delG, NM_000231.2:c.521delT250,600
SGSHMucopolysaccharidosis type 3A (Sanfilippo disease type A)NM_000199.3NM_000199.3:c.1167C>A, NM_000199.3:c.1298G>A, NM_000199.3:c.130G>A, NM_000199.3:c.1339G>A, NM_000199.3:c.1380delT, NM_000199.3:c.197C>G, NM_000199.3:c.220C>T, NM_000199.3:c.235A>C, NM_000199.3:c.320delT, NM_000199.3:c.337_345delinsGCACAGGTGAG, NM_000199.3:c.364G>A, NM_000199.3:c.383C>T, NM_000199.3:c.416C>T, NM_000199.3:c.449G>A, NM_000199.3:c.466A>T, NM_000199.3:c.617G>C, NM_000199.3:c.752G>C, NM_000199.3:c.757delG, NM_000199.3:c.877C>T, NM_000199.3:c.892T>C250,600
SH2D1ALymphoproliferative syndrome type 1, X-linkedNM_002351.4NM_002351.4:c.163C>T, NM_002351.4:c.164G>T, NM_002351.4:c.172C>T, NM_002351.4:c.203C>T, NM_002351.4:c.302C>T, NM_002351.4:c.3G>T, NM_002351.4:c.95G>C600
SH3TC2Charcot-Marie-Tooth disease type 4CNM_024577.3NM_024577.3:c.1586G>A, NM_024577.3:c.1747_1748delAG, NM_024577.3:c.1969G>A, NM_024577.3:c.1972C>T, NM_024577.3:c.1982T>C, NM_024577.3:c.217_227delGCTGCTCGGAGinsCCAGTAA, NM_024577.3:c.2191delG, NM_024577.3:c.2491_2492delAG, NM_024577.3:c.2710C>T, NM_024577.3:c.2829T>G, NM_024577.3:c.2860C>T, NM_024577.3:c.28delG, NM_024577.3:c.2993_2994insC, NM_024577.3:c.3325C>T, NM_024577.3:c.3326G>C, NM_024577.3:c.3341delC, NM_024577.3:c.3601C>T, NM_024577.3:c.3686A>T, NM_024577.3:c.505T>C, NM_024577.3:c.52+1delG, NM_024577.3:c.530-2A>G, NM_024577.3:c.735G>A, NM_024577.3:c.920G>A, NM_024577.3:c.3676-1G>A, NM_024577.3:c.1724T>A, NM_024577.3:c.53-1G>C250,600
SIL1Marinesco-Sjögren syndromeNM_022464.4NM_022464.4:c.1312C>T, NM_022464.4:c.274C>T, NM_022464.4:c.331C>T600
SIX6Anophthalmia or microphthalmia, isolatedNM_007374.2NM_007374.2:c.493A>G, NM_007374.2:c.532_536delAACCG, NM_007374.2:c.635C>T, NM_007374.2:c.725G>T600
SLC12A1Bartter syndrome type 1NM_000338.2NM_000338.2:c.1875G>A, NM_000338.2:c.1942G>A, NM_000338.2:c.2805_2806insA, NM_000338.2:c.347G>A, NM_000338.2:c.611T>C, NM_000338.2:c.628+2T>C, NM_000338.2:c.814G>T, NM_000338.2:c.223C>T, NM_000338.2:c.2952_2955delCAAA250,600
SLC12A6Agenesis of the corpus callosum with neuropathyNM_133647.1NM_133647.1:c.1584_1585delCTinsG, NM_133647.1:c.2023C>T, NM_133647.1:c.3031C>T, NM_133647.1:c.619C>T, NM_133647.1:c.316+1G>A, NM_133647.1:c.366T>G600
SLC17A5Sialic acid storage diseaseNM_012434.4NM_012434.4:c.115C>T, NM_012434.4:c.406A>G, NM_012434.4:c.43G>T, NM_012434.4:c.918T>G, NM_012434.4:c.1259+1G>A, NM_012434.4:c.500T>C250,600
SLC24A1Night blindness, congenital stationary type 1DNM_004727.2NM_004727.2:c.1963C>T250,600
SLC25A13Citrullinemia type 2NM_014251.2NM_014251.2:c.1078C>T, NM_014251.2:c.1177+1G>A, NM_014251.2:c.1311+1G>A, NM_014251.2:c.1592G>A, NM_014251.2:c.1799dupA, NM_014251.2:c.1801G>A, NM_014251.2:c.1801G>T, NM_014251.2:c.1813C>T, NM_014251.2:c.615+1G>C, NM_014251.2:c.615+5G>A, NM_014251.2:c.674C>A, NM_014251.2:c.674C>T, NM_014251.2:c.852_855delTATG, NM_014251.2:c.1231-1G>A, NM_014251.2:c.1411_1412delCT600
SLC25A15Hyperornithinemia - hyperammonemia - homocitrullinuria syndromeNM_014252.3NM_014252.3:c.110T>G, NM_014252.3:c.212T>A, NM_014252.3:c.535C>T, NM_014252.3:c.538G>A, NM_014252.3:c.562_564delTTC, NM_014252.3:c.569G>A, NM_014252.3:c.658G>A, NM_014252.3:c.815C>T, NM_014252.3:c.824G>A, NM_014252.3:c.44C>T600
SLC25A22Epileptic encephalopathy, early infantile, type 3NM_024698.5NM_024698.5:c.617C>T, NM_024698.5:c.706G>T600
SLC26A2Achondrogenesis type 1BNM_000112.3NM_000112.3:c.1020_1022delTGT, NM_000112.3:c.1273A>G, NM_000112.3:c.532C>T, NM_000112.3:c.2033G>T250,600
SLC26A2Atelosteogenesis type 2NM_000112.3NM_000112.3:c.1535C>A, NM_000112.3:c.835C>T250,600
SLC26A2Diastrophic dysplasiaNM_000112.3NM_000112.3:c.1724delA, NM_000112.3:c.1878delG, NM_000112.3:c.1361A>C, NM_000112.3:c.767T>C, NM_000112.3:c.833delC, NM_000112.3:c.496G>A, NM_000112.3:c.1957T>A250,600
SLC26A4Deafness type 4, autosomal recessiveNM_000441.1NM_000441.1:c.1001G>T, NM_000441.1:c.1034T>A, NM_000441.1:c.2162C>T, NM_000441.1:c.1975G>C, NM_000441.1:c.1174A>T, NM_000441.1:c.2131G>A, NM_000441.1:c.1454C>T, NM_000441.1:c.1468A>C, NM_000441.1:c.2211G>C, NM_000441.1:c.269C>T, NM_000441.1:c.916dupG, NM_000441.1:c.281C>T, NM_000441.1:c.1634T>G, NM_000441.1:c.1707+5G>A, NM_000441.1:c.1489G>A, NM_000441.1:c.961A>T, NM_000441.1:c.2048T>C, NM_000441.1:c.898A>C, NM_000441.1:c.918+2T>C, NM_000441.1:c.1001+1G>T, NM_000441.1:c.970A>T, NM_000441.1:c.563T>C250,600
SLC26A4Pendred syndromeNM_000441.1NM_000441.1:c.1246A>C, NM_000441.1:c.1826T>G, NM_000441.1:c.1229C>T, NM_000441.1:c.1263+1G>A, NM_000441.1:c.1061T>C, NM_000441.1:c.1790T>C, NM_000441.1:c.2168A>G, NM_000441.1:c.1151A>G, NM_000441.1:c.1226G>A, NM_000441.1:c.1003T>C, NM_000441.1:c.919-2A>G, NM_000441.1:c.554G>C, NM_000441.1:c.626G>T, NM_000441.1:c.1334T>G, NM_000441.1:c.1198delT, NM_000441.1:c.412G>T, NM_000441.1:c.707T>C250,600
SLC26A5Deafness type 61, autosomal recessiveNM_198999.2NM_198999.2:c.209G>A, NM_198999.2:c.390A>C, NM_198999.2:c.152+1G>A, NM_198999.2:c.1A>G600
SLC35A1Congenital disorder of glycosylation type 2FNM_006416.4NM_006416.4:c.277_280delGTGCinsTG600
SLC35C1Congenital disorder of glycosylation 2cNM_018389.4NM_018389.4:c.439C>T, NM_018389.4:c.91G>T, NM_018389.4:c.923C>G, NM_018389.4:c.290dupG, NM_018389.4:c.503_505delTCT600
SLC35D1Schneckenbecken dysplasiaNM_015139.2NM_015139.2:c.319C>T, NM_015139.2:c.932G>A600
SLC37A4Glycogen storage disease types 1b, 1c and 1dNM_001164278.1NM_001164278.1:c.1042_1043delCT, NM_001164278.1:c.1081G>T, NM_001164278.1:c.1082G>A, NM_001164278.1:c.1108_1109delCT, NM_001164278.1:c.1129G>T, NM_001164278.1:c.1190-2_1190-1delAG, NM_001164278.1:c.1309C>T, NM_001164278.1:c.287G>A, NM_001164278.1:c.352T>C, NM_001164278.1:c.593A>T, NM_001164278.1:c.706_708delGTG, NM_001164278.1:c.83G>A, NM_001164278.1:c.899G>A250,600
SLC45A2Albinism, oculocutaneous, type 4NM_016180.3NM_016180.3:c.1121delT, NM_016180.3:c.469G>A, NM_016180.3:c.986delC600
SLC4A11Congenital hereditary endothelial dystrophy type 2NM_032034.3NM_032034.3:c.1038_1039insA, NM_032034.3:c.1391G>A, NM_032034.3:c.2318C>T, NM_032034.3:c.1466C>T, NM_032034.3:c.1813C>T, NM_032034.3:c.2264G>A, NM_032034.3:c.2605C>T, NM_032034.3:c.2399C>T, NM_032034.3:c.554_561delGCTTCGCC, NM_032034.3:c.2606G>A250,600
SLC4A11Corneal dystrophy and perceptive deafnessNM_032034.3NM_032034.3:c.2528T>C, NM_032034.3:c.1463G>A, NM_032034.3:c.473_480delGCTTCGCC, NM_032034.3:c.2566A>G, NM_032034.3:c.637T>C, NM_032034.3:c.625C>T, NM_032034.3:c.2224G>A, NM_032034.3:c.2240_2240+1insTATGACAC250,600
SLC6A8Cerebral creatine deficiency syndrome type 1NM_005629.3NM_005629.3:c.1011C>G, NM_005629.3:c.1141G>C, NM_005629.3:c.1222_1224delTTC, NM_005629.3:c.1540C>T, NM_005629.3:c.321_323delCTT, NM_005629.3:c.395G>T600
SLX4Fanconi anemia, complementation group PNM_032444.2NM_032444.2:c.1093delC, NM_032444.2:c.286delA, NM_032444.2:c.4921_4922insG, NM_032444.2:c.5097_5098delTC, NM_032444.2:c.5408_5409insAC, NM_032444.2:c.4739+1G>T, NM_032444.2:c.2808_2809delAG250,600
SMN1Spinal muscular atrophy-del ex7, del ex7-8250,600
SMPD1Niemann-Pick diseaseNM_000543.4NM_000543.4:c.103_118delCTGGTGCTGGCGCTGG, NM_000543.4:c.103_119delCTGGTGCTGGCGCTGGC, NM_000543.4:c.103_107delCTGGT, NM_000543.4:c.103_113delCTGGTGCTGGCGinsCTGGTG, NM_000543.4:c.1092-1G>C, NM_000543.4:c.1117C>T, NM_000543.4:c.106delG, NM_000543.4:c.108_124delGCTGGCGCTGGCGCTGGC, NM_000543.4:c.1267C>T, NM_000543.4:c.1299T>G, NM_000543.4:c.1327C>T, NM_000543.4:c.1420_1421delCT, NM_000543.4:c.1426C>T, NM_000543.4:c.1624C>T, NM_000543.4:c.1630delA, NM_000543.4:c.1805G>A, NM_000543.4:c.354delC, NM_000543.4:c.475T>C, NM_000543.4:c.551C>T, NM_000543.4:c.557C>T, NM_000543.4:c.558_559insC, NM_000543.4:c.558_574delGCCCCCCAAACCCCCTA, NM_000543.4:c.564delC, NM_000543.4:c.573delT, NM_000543.4:c.689G>A, NM_000543.4:c.730G>A, NM_000543.4:c.739G>A, NM_000543.4:c.740delG, NM_000543.4:c.742G>A, NM_000543.4:c.757G>C, NM_000543.4:c.785_807delTGTTGAGTGGGCTGGGCCCAGCC, NM_000543.4:c.788T>A, NM_000543.4:c.842_849dupTCCCCGCA, NM_000543.4:c.911T>C, NM_000543.4:c.940G>A, NM_000543.4:c.96G>A, NM_000543.4:c.996delC, NM_000543.4:c.688C>T, NM_000543.4:c.995C>G, NM_000543.4:c.1829_1831delGCC, NM_000543.4:c.1264-1G>T, NM_000543.4:c.1152G>A250,600
SNAI2Waardenburg syndrome type 2NM_003068.4NM_003068.4:c.357C>A600
SNAP29Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndromeNM_004782.3NM_004782.3:c.487dupA600
SPG11Spastic paraplegia type 11NM_025137.3NM_025137.3:c.118C>T, NM_025137.3:c.529_533delATATT, NM_025137.3:c.5623C>T, NM_025137.3:c.1339_1342dupGGCT, NM_025137.3:c.342delT, NM_025137.3:c.7152-1G>C, NM_025137.3:c.733_734delAT, NM_025137.3:c.6805_6806delCT, NM_025137.3:c.1736-1G>C, NM_025137.3:c.6100C>T, NM_025137.3:c.6848_6849insTC250,600
SPG20Spastic paraplegia type 20, autosomal recessiveNM_015087.4NM_015087.4:c.1110delA, NM_015087.4:c.364_365delAT600
SPG7Spastic paraplegia type 7NM_003119.3NM_003119.3:c.1457G>A, NM_003119.3:c.1529C>T, NM_003119.3:c.2075G>C, NM_003119.3:c.233T>A, NM_003119.3:c.1676delA, NM_003119.3:c.1749G>C, NM_003119.3:c.773_774delTG, NM_003119.3:c.1045G>A, NM_003119.3:c.1124delG, NM_003119.3:c.679C>T, NM_003119.3:c.758+2T>C, NM_003119.3:c.286+1G>T250,600
STARLipoid adrenal hyperplasiaNM_000349.2NM_000349.2:c.545G>T, NM_000349.2:c.559G>A, NM_000349.2:c.545G>A, NM_000349.2:c.749G>A, NM_000349.2:c.772C>T, NM_000349.2:c.562C>T, NM_000349.2:c.577C>T600
STILMicrocephaly primary, type 7, autosomal recessiveNM_003035.2NM_003035.2:c.3655delG, NM_003035.2:c.3715C>T, NM_003035.2:c.3843_3846delACAG, NM_003035.2:c.2392T>G, NM_003035.2:c.2826+1G>A600
STRA6Syndromic microphthalmia type 9NM_022369.3NM_022369.3:c.1678G>C, NM_022369.3:c.1699C>T, NM_022369.3:c.147delC, NM_022369.3:c.1521-1G>A, NM_022369.3:c.1964G>A, NM_022369.3:c.277_278insCC, NM_022369.3:c.1931C>T, NM_022369.3:c.1963C>T, NM_022369.3:c.69G>A, NM_022369.3:c.878C>T, NM_022369.3:c.910_911delGGinsAA, NM_022369.3:c.52_53delTAinsC, NM_022369.3:c.527_528insG600
STRCDeafness type 16, autosomal recessiveNM_153700.2NM_153700.2:c.4561_4562insC, NM_153700.2:c.5188C>T, NM_153700.2:c.3556C>T, NM_153700.2:c.5168_5171delTTCT, NM_153700.2:c.5185C>T, NM_153700.2:c.4545+1G>C250,600
SUCLG1Fatal infantile lactic acidosis with methylmalonic aciduriaNM_003849.3NM_003849.3:c.152_153delAT, NM_003849.3:c.626C>A600
SUOXSulfocysteinuriaNM_000456.2NM_000456.2:c.37C>T, NM_000456.2:c.894_895delCT, NM_000456.2:c.650G>A, NM_000456.2:c.794C>A600
TAF1Dystonia-Parkinsonism, X-linkedNM_004606.4NM_004606.4:c.417_418insCATAATCTATGATAATGATAAT600
TATTyrosinemia type 2NM_000353.2NM_000353.2:c.1249C>T, NM_000353.2:c.236-5A>G, NM_000353.2:c.668C>G, NM_000353.2:c.1297C>T, NM_000353.2:c.169C>T600
TBCEHypoparathyroidism-retardation-dysmorphism syndromeNM_003193.4NM_003193.4:c.1491_1492insGTAAA600
TCAPCardiomyopathy, hypertrophic, type 25NM_003673.3NM_003673.3:c.260G>A, NM_003673.3:c.316C>T250,600
TCAPLimb-girdle muscular dystrophy type 2GNM_003673.3NM_003673.3:c.157C>T250,600
TCIRG1Osteopetrosis type 1, autosomal recessiveNM_006019.3NM_006019.3:c.1331G>T, NM_006019.3:c.1674-1G>A, NM_006019.3:c.179A>G, NM_006019.3:c.2236+1G>A, NM_006019.3:c.2415-3C>G, NM_006019.3:c.112_113delAG, NM_006019.3:c.1213G>A250,600
TECTADeafness type 21, autosomal recessiveNM_005422.2NM_005422.2:c.2428C>T, NM_005422.2:c.2941+1G>A, NM_005422.2:c.651_652insC, NM_005422.2:c.4370_4371insTCAGTGCGACCCGC, NM_005422.2:c.4601G>A600
TERTDyskeratosis congenita, autosomal recessiveNM_198253.2NM_198253.2:c.1234C>T, NM_198253.2:c.835G>A, NM_198253.2:c.2701C>T, NM_198253.2:c.2431C>T250,600
TFR2Hemochromatosis, type 3NM_003227.3NM_003227.3:c.1330G>A, NM_003227.3:c.1403G>A, NM_003227.3:c.1469T>G, NM_003227.3:c.1235_1237delACA, NM_003227.3:c.1861_1872delGCCGTGGCCCAG, NM_003227.3:c.2343G>A, NM_003227.3:c.313C>T, NM_003227.3:c.1665delC, NM_003227.3:c.750C>G, NM_003227.3:c.840C>G, NM_003227.3:c.949C>T, NM_003227.3:c.515T>A, NM_003227.3:c.1632_1633delGA, NM_003227.3:c.2014C>T, NM_003227.3:c.2374G>A, NM_003227.3:c.1473+1G>A, NM_003227.3:c.1186C>T250,600
THSegawa syndrome, autosomal recessiveNM_000360.3NM_000360.3:c.1141C>A, NM_000360.3:c.614T>C, NM_000360.3:c.733A>C, NM_000360.3:c.1388C>T, NM_000360.3:c.605G>A, NM_000360.3:c.917G>A600
TIMM8AMohr-Tranebjaerg syndromeNM_004085.3NM_004085.3:c.198C>G, NM_004085.3:c.238C>T, NM_004085.3:c.112C>T600
TK2Mitochondrial DNA depletion syndrome type 2NM_004614.4NM_004614.4:c.323C>T, NM_004614.4:c.361C>A, NM_004614.4:c.373C>T, NM_004614.4:c.500G>A, NM_004614.4:c.604_606delAAG, NM_004614.4:c.635T>A, NM_004614.4:c.623A>G, NM_004614.4:c.159C>G, NM_004614.4:c.268C>T250,600
TMC1Deafness type 7, autosomal recessiveNM_138691.2NM_138691.2:c.1763+3A>G, NM_138691.2:c.1842G>A, NM_138691.2:c.100C>T, NM_138691.2:c.1165C>T, NM_138691.2:c.425G>A, NM_138691.2:c.454-1G>C, NM_138691.2:c.1960A>G600
TMEM216Joubert syndrome type 2NM_001173990.2NM_001173990.2:c.218G>T, NM_001173990.2:c.218G>A, NM_001173990.2:c.79_82delAACG600
TMEM216Meckel syndrome type 2NM_001173990.2NM_001173990.2:c.230G>C, NM_001173990.2:c.253C>T, NM_001173990.2:c.341T>G600
TMEM67COACH syndromeNM_153704.5NM_153704.5:c.1769T>C, NM_153704.5:c.2498T>C250,600
TMEM67Joubert syndrome type 6NM_153704.5NM_153704.5:c.130C>T, NM_153704.5:c.148_149insTAAT, NM_153704.5:c.1538A>G250,600
TMEM67Meckel syndrome type 3NM_153704.5NM_153704.5:c.1309C>G, NM_153704.5:c.755T>C, NM_153704.5:c.1046T>C, NM_153704.5:c.653G>C, NM_153704.5:c.406+1402_406+1403insTAAT, NM_153704.5:c.622A>T250,600
TMIEDeafness type 6, autosomal recessiveNM_147196.2NM_147196.2:c.241C>T, NM_147196.2:c.250C>T, NM_147196.2:c.170G>A, NM_147196.2:c.257G>A600
TMPRSS3Deafness types 8/10, autosomal recessiveNM_024022.2NM_024022.2:c.1211C>T, NM_024022.2:c.1276G>A, NM_024022.2:c.1159G>A, NM_024022.2:c.413C>A, NM_024022.2:c.446+1G>T, NM_024022.2:c.647G>T, NM_024022.2:c.753G>C, NM_024022.2:c.646C>T, NM_024022.2:c.208delC, NM_024022.2:c.242C>G250,600
TNNT1Nemaline myopathy type 5NM_003283.5NM_003283.5:c.538G>T600
TPP1Neuronal ceroid-lipofuscinoses type 2NM_000391.3NM_000391.3:c.1093T>C, NM_000391.3:c.616C>T, NM_000391.3:c.622C>T, NM_000391.3:c.1340G>A, NM_000391.3:c.141_144delGAGT, NM_000391.3:c.827A>T, NM_000391.3:c.509-1G>C, NM_000391.3:c.851G>T250,600
TPRNDeafness type 79, autosomal recessiveNM_001128228.2NM_001128228.2:c.1427delC, NM_001128228.2:c.1239G>A600
TREX1Aicardi-Goutieres syndrome type 1NM_033629.4NM_033629.4:c.341G>A, NM_033629.4:c.144_145insC, NM_033629.4:c.490C>T, NM_033629.4:c.506G>A600
TRIM32Limb-girdle muscular dystrophy type 2HNM_012210.3NM_012210.3:c.1459G>A, NM_012210.3:c.1560delC600
TRIM37Mulibrey nanismNM_015294.3NM_015294.3:c.1346_1347insA, NM_015294.3:c.1411C>T, NM_015294.3:c.1037_1040dupAGAT, NM_015294.3:c.2056C>T, NM_015294.3:c.2212delG, NM_015294.3:c.227T>C, NM_015294.3:c.326G>C, NM_015294.3:c.496_500delAGGAA, NM_015294.3:c.745C>T, NM_015294.3:c.965G>T, NM_015294.3:c.1478_1479delAG, NM_015294.3:c.1668-1G>C600
TRIOBPDeafness type 28, autosomal recessiveNM_001039141.2NM_001039141.2:c.2362C>T, NM_001039141.2:c.3194delT, NM_001039141.2:c.1039C>T, NM_001039141.2:c.1741C>T, NM_001039141.2:c.4577C>G, NM_001039141.2:c.2639_2640insTCAC, NM_001039141.2:c.5316G>A, NM_001039141.2:c.3202C>T, NM_001039141.2:c.4429_4430insG250,600
TSEN54Pontocerebellar hypoplasiaNM_207346.2NM_207346.2:c.670_671delAA, NM_207346.2:c.736C>T, NM_207346.2:c.1027C>T, NM_207346.2:c.1039A>T, NM_207346.2:c.887G>A, NM_207346.2:c.919G>T250,600
TSFMCombined oxidative phosphorylation deficiency type 3NM_001172696.1NM_001172696.1:c.1_2delAT, NM_001172696.1:c.580delC, NM_001172696.1:c.919C>T, NM_001172696.1:c.21_22delGC250,600
TSHBIsolated thyroid-stimulating hormone deficiencyNM_000549.4NM_000549.4:c.94G>T, NM_000549.4:c.205C>T, NM_000549.4:c.145G>A600
TSHRHypothyroidismNM_000369.2NM_000369.2:c.100G>A, NM_000369.2:c.1170T>G, NM_000369.2:c.484C>G, NM_000369.2:c.500T>A, NM_000369.2:c.122G>C, NM_000369.2:c.326G>A, NM_000369.2:c.1741_1742insC, NM_000369.2:c.202C>T250,600
TTNCardiomyopathy, dilated/Tibial muscular dystrophyNM_133378.4NM_133378.4:c.13149C>A, NM_133378.4:c.22246G>A, NM_133378.4:c.31780G>A, NM_133378.4:c.40211dupT, NM_133378.4:c.44668delG, NM_133378.4:c.52977dupT, NM_133378.4:c.61640C>G, NM_133378.4:c.84669_84675delTGAATTC, NM_133378.4:c.94567C>T, NM_133378.4:c.96388C>T, NM_133378.4:c.96388delC, NM_133378.4:c.98366_98367delAT, NM_133378.4:c.12064C>T, NM_133378.4:c.28739-1G>A, NM_133378.4:c.3165-1G>T, NM_133378.4:c.4724_4728delTGAAA, NM_133378.4:c.48944-1G>A, NM_133378.4:c.91114_91117delTCCA, NM_133378.4:c.100185delA, NM_133378.4:c.40549delA, NM_133378.4:c.24568_24571delAGCA250,600
TTPAAtaxia with vitamin E deficiencyNM_000370.3NM_000370.3:c.661C>T, NM_000370.3:c.744delA, NM_000370.3:c.575G>A250,600
TULP1Leber congenital amaurosis type 15NM_003322.4NM_003322.4:c.1198C>T, NM_003322.4:c.1204G>T600
TULP1Retinitis pigmentosa type 14NM_003322.4NM_003322.4:c.1259G>C, NM_003322.4:c.1318C>T, NM_003322.4:c.1471T>C, NM_003322.4:c.1511_1521delTGCAGTTCGGC, NM_003322.4:c.1376T>A, NM_003322.4:c.1444C>T600
TYROculocutaneous albinism type 1NM_000372.4NM_000372.4:c.1012_1013insC, NM_000372.4:c.1146C>A, NM_000372.4:c.1164delT, NM_000372.4:c.1177delG, NM_000372.4:c.1147G>A, NM_000372.4:c.115T>G, NM_000372.4:c.1255G>A, NM_000372.4:c.1265G>A, NM_000372.4:c.1209G>T, NM_000372.4:c.1217C>T, NM_000372.4:c.140G>A, NM_000372.4:c.1467dupT, NM_000372.4:c.1501dupC, NM_000372.4:c.164G>A, NM_000372.4:c.1A>G, NM_000372.4:c.230G>A, NM_000372.4:c.242C>T, NM_000372.4:c.265T>C, NM_000372.4:c.272G>A, NM_000372.4:c.286dupA, NM_000372.4:c.533G>A, NM_000372.4:c.1336G>A, NM_000372.4:c.1342G>A, NM_000372.4:c.646T>A, NM_000372.4:c.650G>A, NM_000372.4:c.823G>T, NM_000372.4:c.896G>A, NM_000372.4:c.1111A>G, NM_000372.4:c.1118C>A, NM_000372.4:c.325G>A, NM_000372.4:c.572delG, NM_000372.4:c.616G>A250,600
TYRP1Oculocutaneous albinism type 3NM_000550.2NM_000550.2:c.107delT, NM_000550.2:c.1103delA, NM_000550.2:c.1057_1060delAACA, NM_000550.2:c.1067G>A, NM_000550.2:c.1557T>G, NM_000550.2:c.176C>G, NM_000550.2:c.497C>G, NM_000550.2:c.1120C>T, NM_000550.2:c.1369_1370insCAGA250,600
UBA1Spinal muscular atrophy type 2, X-linkedNM_003334.3NM_003334.3:c.1731C>T600
UBR1Johanson-Blizzard syndromeNM_174916.2NM_174916.2:c.869C>G, NM_174916.2:c.4254G>A, NM_174916.2:c.1281+1G>T, NM_174916.2:c.1537C>T600
UGT1A1Crigler-Najjar syndrome type 1NM_000463.2NM_000463.2:c.1021C>T, NM_000463.2:c.1070A>G250,600
UGT1A1Crigler-Najjar syndrome type 2NM_000463.2NM_000463.2:c.1207C>T, NM_000463.2:c.674T>G, NM_000463.2:c.1130G>T, NM_000463.2:c.524T>A, NM_000463.2:c.44T>G250,600
UGT1A1Gilbert syndromeNM_000463.2NM_000463.2:c.1211T>C, NM_000463.2:c.1456T>G250,600
UQCRQMitochondrial complex III deficiency, nuclear type 4NM_014402.4NM_014402.4:c.134C>T600
USH1CUsher syndrome type 1CNM_153676.3NM_153676.3:c.216G>A, NM_153676.3:c.2362G>A, NM_153676.3:c.2622_2623delCA, NM_153676.3:c.2688_2695dupAATTCACC, NM_153676.3:c.238_239insC, NM_153676.3:c.238delC, NM_153676.3:c.2547-1G>T, NM_153676.3:c.2695_2696insAATTCACC, NM_153676.3:c.388G>A250,600
USH1GUsher syndrome type 1GNM_173477.4NM_173477.4:c.186_187delCA, NM_173477.4:c.394_395insG, NM_173477.4:c.832_851delTCGGACGAGGACAGCGTCTC, NM_173477.4:c.649C>T, NM_173477.4:c.805C>T600
USH2ARetinitis pigmentosa type 39NM_206933.2NM_206933.2:c.10073G>A, NM_206933.2:c.2296T>C, NM_206933.2:c.14519T>C, NM_206933.2:c.7364G>A, NM_206933.2:c.12574C>T, NM_206933.2:c.2276G>T250,600
USH2AUsher syndrome type 2ANM_206933.2NM_206933.2:c.10636G>A, NM_206933.2:c.10561T>C, NM_206933.2:c.15371delT, NM_206933.2:c.2167+5G>A, NM_206933.2:c.11864G>A, NM_206933.2:c.14803C>T, NM_206933.2:c.2898delG, NM_206933.2:c.3491_3492delCT, NM_206933.2:c.11549-5_11549-4insT, NM_206933.2:c.2299delG, NM_206933.2:c.5975A>G, NM_206933.2:c.6670G>T, NM_206933.2:c.6862G>T, NM_206933.2:c.5743_5744delAG, NM_206933.2:c.779T>G, NM_206933.2:c.820C>T, NM_206933.2:c.8981G>A, NM_206933.2:c.956G>A, NM_206933.2:c.9799T>C, NM_206933.2:c.15089C>A, NM_206933.2:c.2135delC, NM_206933.2:c.4338_4339delCT, NM_206933.2:c.5573-2A>G, NM_206933.2:c.920_923dupGCCA, NM_206933.2:c.13709delG, NM_206933.2:c.14926G>A, NM_206933.2:c.15520-1G>A, NM_206933.2:c.8431C>A, NM_206933.2:c.12234_12235delGA, NM_206933.2:c.14442C>A250,600
VDRRickets, vitamin D-resistant, type 2ANM_001017535.1NM_001017535.1:c.137G>A, NM_001017535.1:c.149G>A, NM_001017535.1:c.885C>A, NM_001017535.1:c.88C>T, NM_001017535.1:c.239G>A, NM_001017535.1:c.821G>T, NM_001017535.1:c.88C>G, NM_001017535.1:c.915C>G, NM_001017535.1:c.985G>A600
VLDLRCerebellar ataxia, mental retardation, and dysequilibrium syndrome type 1NM_003383.3NM_003383.3:c.2339delT, NM_003383.3:c.2302_2303delGA, NM_003383.3:c.844C>T, NM_003383.3:c.769C>T600
VPS13AChoreoacanthocytosisNM_033305.2NM_033305.2:c.622C>T, NM_033305.2:c.9109C>T, NM_033305.2:c.2898T>G, NM_033305.2:c.3091delG, NM_033305.2:c.9275+1G>T600
VPS33BArthrogryposis-renal dysfunction-cholestasis type 1NM_018668.4NM_018668.4:c.1246C>T, NM_018668.4:c.1312C>T, NM_018668.4:c.1498G>A, NM_018668.4:c.440_449delCTCTTGATGT, NM_018668.4:c.1594C>T, NM_018668.4:c.1480-1G>T, NM_018668.4:c.603+2T>A600
WASNeutropenia, severe congenital, X-linkedNM_000377.2NM_000377.2:c.881T>C, NM_000377.2:c.809T>C, NM_000377.2:c.814T>C600
WASThrombocytopaenia type 1NM_000377.2NM_000377.2:c.167C>T, NM_000377.2:c.173C>G, NM_000377.2:c.1442T>A600
WASWiskott-Aldrich syndromeNM_000377.2NM_000377.2:c.134C>T600
WDR62Microcephaly primary, type 2, autosomal recessiveNM_001083961.1NM_001083961.1:c.1313G>A, NM_001083961.1:c.3514+1delG, NM_001083961.1:c.3574delA, NM_001083961.1:c.1408C>T, NM_001083961.1:c.193G>A, NM_001083961.1:c.702dupG, NM_001083961.1:c.671G>C, NM_001083961.1:c.557G>A600
WFS1Wolfram syndromeNM_006005.3NM_006005.3:c.1234_1237delGTCT, NM_006005.3:c.1511C>T, NM_006005.3:c.2168T>C, NM_006005.3:c.2171C>T, NM_006005.3:c.1944G>A, NM_006005.3:c.2084G>T, NM_006005.3:c.577A>C, NM_006005.3:c.676C>T, NM_006005.3:c.2327A>T, NM_006005.3:c.407_408insGGGCCGTCGCGAGGCT, NM_006005.3:c.2576G>A, NM_006005.3:c.2643_2644delCT, NM_006005.3:c.616C>T, NM_006005.3:c.1060_1062delTTC, NM_006005.3:c.400G>A, NM_006005.3:c.1943G>A, NM_006005.3:c.1230_1233delCTCT250,600
WNT10AHypohidrotic ectodermal dysplasia, autosomal recessiveNM_025216.2NM_025216.2:c.347T>C, NM_025216.2:c.383G>A, NM_025216.2:c.321C>A250,600
WNT10AOdontoonychodermal dysplasiaNM_025216.2NM_025216.2:c.697G>T250,600
WNT7AFuhrmann syndromeNM_004625.3NM_004625.3:c.874C>T600
WNT7AUlna and fibula, absence of, with sever limb deficiencyNM_004625.3NM_004625.3:c.325G>A600
XPAXeroderma pigmentosum Group ANM_000380.3NM_000380.3:c.323G>T, NM_000380.3:c.619C>T, NM_000380.3:c.727C>T, NM_000380.3:c.731A>G, NM_000380.3:c.348T>A, NM_000380.3:c.501delG600
ZFYVE26Spastic paraplegia type 15, autosomal recessiveNM_015346.3NM_015346.3:c.3206G>A, NM_015346.3:c.3642_3643insCCACACTTAG, NM_015346.3:c.1477C>T, NM_015346.3:c.2887G>C, NM_015346.3:c.5422C>T, NM_015346.3:c.5485-1G>A, NM_015346.3:c.4312C>T, NM_015346.3:c.4936C>T, NM_015346.3:c.3182delT, NM_015346.3:c.2114_2115insC250,600
ZMPSTE24Mandibuloacral dysplasia with type B lipodystrophyNM_005857.4NM_005857.4:c.121C>T, NM_005857.4:c.1263dupT, NM_005857.4:c.1018T>C, NM_005857.4:c.955-1G>A, NM_005857.4:c.1349G>A600
ZMPSTE24Restrictive dermopathy, lethalNM_005857.4NM_005857.4:c.1076_1077insT, NM_005857.4:c.54dupT, NM_005857.4:c.1085_1086insT600
ZNF469Brittle cornea syndromeNM_001127464.1NM_001127464.1:c.6673delC, NM_001127464.1:c.11452_11453insC, NM_001127464.1:c.4174G>T600
©2020 | All rights reserved. Legal note | Privacy policy | Cookies policy